ING3 cloning plasmid
-
Catalog numberCSB-CL865171HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ING3 gene.
-
SpecificationsGene name: ING3; Gene ID: 54556; Accession number: BC073865; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 300; Sequence: atgttgtacctagaagactatctggaaatgattgagcagcttcctatggatctgcgggaccgcttcacggaaatgcgcgagatggacctgcaggtgcagaatgcaatggatcaactagaacaaagagtcagtgaattctttatgaatgcaaagaaaaataaacctgagtggagggaagagcaaatggcatccatcaaaaaagactactataaagctttggaagatgcagatgagaaggttcagttggcaaaccagatatatgacttggtaagtaaaagtaatgtgcatactgtgccataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolING3
-
Short nameING3 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameinhibitor on growth family, member 3 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetinhibitor of growth family, member 3, ING3 and IDBG-38115 and ENSG00000071243 and 54556, methylated histone binding, nuclei, Ing3 and IDBG-129480 and ENSMUSG00000029670 and 71777, ING3 and IDBG-634682 and ENSBTAG00000016332 and 513000
-
Gene info
-
Identity
-
Gene
-
Long gene nameinhibitor of growth family member 3
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-02-09
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- PHD finger proteins
-
VEGA ID