GNAI2 cloning plasmid
-
Catalog numberCSB-CL009589HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the GNAI2 gene.
-
SpecificationsGene name: GNAI2; Gene ID: 2771; Accession number: BC014627; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1068; Sequence: atgggctgcaccgtgagcgccgaggacaaggcggcggccgagcgctctaagatgatcgacaagaacctgcgggaggacggagagaaggcggcgcgggaggtgaagttgctgctgttgggtgctgtggagtcagggaagagcaccatcgtcaagcagatgaagatcatccacgaggatggctactccgaggaggaatgccggcagtaccgggcggttgtctacagcaacaccatccagtccatcatggccattgtcaaagccatgggcaacctgcagatcgactttgccgacccctccagagcggacgacgccaggcagctatttgcactgtcctgcaccgccgaggagcaaggcgtgctccctgatgacctgtccggcgtcatccggaggctctgggctgaccatggtgtgcaggcctgctttggccgctcaagggaataccagctcaacgactcagctgcctactacctgaacgacctggagcgtattgcacagagtgactacatccccacacagcaagatgtgctacggacccgcgtaaagaccacggggatcgtggagacacacttcaccttcaaggacctacacttcaagatgtttgatgtgggtggtcagcggtctgagcggaagaagtggatccactgctttgagggcgtcacagccatcatcttctgcgtagccttgagcgcctatgacttggtgctagctgaggacgaggagatgaaccgcatgcatgagagcatgaagctattcgatagcatctgcaacaacaagtggttcacagacacgtccatcatcctcttcctcaacaagaaggacctgtttgaggagaagatcacacacagtcccctgaccatctgcttccctgagtacacaggggccaacaaatatgatgaggcagccagctacatccagagtaagtttgaggacctgaataagcgcaaagacaccaaggagatctacacgcacttcacgtgcgccaccgacaccaagaacgtgcagttcgtgtttgacgccgtcaccgatgtcatcatcaagaacaacctgaaggactgcggcctcttctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolGNAI2
-
Short nameGNAI2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameguanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetguanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2, GIP and GNAI2B and H_LUCA15.1 and H_LUCA16.1, GNAI2 and IDBG-36105 and ENSG00000114353 and 2771, metal ion binding, nuclei, Gnai2 and IDBG-198032 and ENSMUSG00000032562 and 14678, GNAI2 and IDBG-645836 and ENSBTAG00000020645 and 281791
-
Gene info
-
Identity
-
Gene
-
Long gene nameG protein subunit alpha i2
-
Synonyms gene
-
Synonyms gene name
- guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1986-01-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- G protein subunits alpha, group i
- MicroRNA protein coding host genes
-
VEGA ID