FCER1G cloning plasmid

• Catalog number
  CSB-CL008533HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the FCER1G gene.
• Specifications
  Gene name: FCER1G; Gene ID: 2207; Accession number: BC033872; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 264; Sequence: atgattccagcagtggtcttgctcttactccttttggttgaacaagcagcggccctgggagagcctcagctctgctatatcctggatgccatcctgtttctgtatggaattgtcctcaccctcctctactgtcgactgaaggtaatccaagtgcgaaaggcagctataaccagctatgagaaatcagatggtgtttacacgggcctgagcaccaggaaccaggagacttacgagactctgaagcatgagaaaccaccacagtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  FCER1G   cloning  
• Gene symbol
  FCER1G
• Short name
  FCER1G cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  fragment c fragment on immunoglobuline E, high affinity I, receptor to measure; g polypeptide cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide, FCRG, FCER1G and IDBG-104229 and ENSG00000158869 and 2207, IgG binding, Cell surfaces, Fcer1g and IDBG-204231 and ENSMUSG00000058715 and 14127, FCER1G and IDBG-630137 and ENSBTAG00000024503 and 282226

Gene info

• Identity
  HGNC:3611
• Gene
  FCER1G
• Long gene name
  Fc fragment of IgE receptor Ig
• Synonyms gene name
  • Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide
• Synonyms name
  • Fc epsilon receptor Ig
• Locus
  1q23.3
• Discovery year
  1990-08-15
• Entrez gene record
  2207
• Pubmed identfication
  • 2138619
• RefSeq identity
  • NM_004106
• VEGA ID
  OTTHUMG00000034343

Similar products