AQP3 cloning plasmid

• Catalog number
  CSB-CL849752HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the AQP3 gene.
• Specifications
  Gene name: AQP3; Gene ID: 360; Accession number: BC013566; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 879; Sequence: atgggtcgacagaaggagctggtgtcccgctgcggggagatgctccacatccgctaccggctgctccgacaggcgctggccgagtgcctggggaccctcatcctggtgatgtttggctgtggctccgtggcccaggttgtgctcagccggggcacccacggtggtttcctcaccatcaacctggcctttggctttgctgtcactctgggcatcctcatcgctggccaggtctctggggcccacctgaaccctgccgtgacctttgccatgtgcttcctggctcgtgagccctggatcaagctgcccatctacaccctggcacagacgctgggagccttcttgggtgctggaatagtttttgggctgtattatgatgcaatctggcacttcgccgacaaccagctttttgtttcgggccccaatggcacagccggcatctttgctacctacccctctggacacttggatatgatcaatggcttctttgaccagttcataggcacagcctcccttatcgtgtgtgtgctggccattgttgacccctacaacaaccccgtcccccgaggcctggaggccttcaccgtgggcctggtggtcctggtcattggcacctccatgggcttcaactccggctatgccgtcaaccctgcccgggactttggcccccgcctttttacagcccttgcgggctggggctctgcagtcttcacgaccggccagcattggtggtgggtgcccatcgtgtccccactcctgggctccattgcgggtgtcttcgtgtaccagctgatgatcggctgccacctggagcagcccccaccctccaacgaggaagagaatgtgaagctggcccatgtgaagcacaaggagcagatctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  AQP3   cloning  
• Gene symbol
  AQP3
• Short name
  AQP3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  aquaporin 3 (Gill blood group) cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  aquaporin 3 (Gill blood group), AQP-3 and GIL, AQP3 and IDBG-57960 and ENSG00000165272 and 360, glycerol channel activity, Cell surfaces, Aqp3 and IDBG-137002 and ENSMUSG00000028435 and 11828, AQP3 and IDBG-635798 and ENSBTAG00000008493 and 780866

Gene info

• Identity
  HGNC:636
• Gene
  AQP3
• Long gene name
  aquaporin 3 (Gill blood group)
• Synonyms gene name
  • aquaporin 3
  • aquaporin 3 (GIL blood group)
• Synonyms
  • GIL
• Synonyms name
  • Gill blood group
• Locus
  9p13.3
• Discovery year
  1994-07-25
• Entrez gene record
  360
• Pubmed identfication
  • 7558005
• RefSeq identity
  • NM_004925
• Classification
  • Aquaporins
  • Blood group antigens
• VEGA ID
  OTTHUMG00000019769
• Locus Specific Databases
  • LRG_821

Similar products