FOS cloning plasmid

  • Catalog number
    CSB-CL008790HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the FOS gene.
  • Specifications
    Gene name: FOS; Gene ID: 2353; Accession number: BC004490; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1143; Sequence: atgatgttctcgggcttcaacgcagactacgaggcgtcatcctcccgctgcagcagcgcgtccccggccggggatagcctctcttactaccactcacccgcagactccttctccagcatgggctcgcctgtcaacgcgcaggacttctgcacggacctggccgtctccagtgccaacttcattcccacggtcactgccatctcgaccagtccggacctgcagtggctggtgcagcccgccctcgtctcctctgtggccccatcgcagaccagagcccctcaccctttcggagtccccgccccctccgctggggcttactccagggctggcgttgtgaagaccatgacaggaggccgagcgcagagcattggcaggaggggcaaggtggaacagttatctccagaagaagaagagaaaaggagaatccgaagggaaaggaataagatggctgcagccaaatgccgcaaccggaggagggagctgactgatacactccaagcggagacagaccaactagaagatgagaagtctgctttgcagaccgagattgccaacctgctgaaggagaaggaaaaactagagttcatcctggcagctcaccgacctgcctgcaagatccctgatgacctgggcttcccagaagagatgtctgtggcttcccttgatctgactgggggcctgccagaggttgccaccccggagtctgaggaggccttcaccctgcctctcctcaatgaccctgagcccaagccctcagtggaacctgtcaagagcatcagcagcatggagctgaagaccgagccctttgatgacttcctgttcccagcatcatccaggcccagtggctctgagacagcccgctccgtgccagacatggacctatctgggtccttctatgcagcagactgggagcctctgcacagtggctccctggggatggggcccatggccacagagctggagcccctgtgcactccggtggtcacctgtactcccagctgcactgcttacacgtcttccttcgtcttcacctaccccgaggctgactccttccccagctgtgcagctgcccaccgcaagggcagcagcagcaatgagccttcctctgactcgctcagctcacccacgctgctggccctgtga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    FOS   cloning  
  • Gene symbol
    FOS
  • Short name
    FOS cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    FBJ murine osteosarcoma viral oncogene homolog cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    FBJ murine osteosarcoma viral oncogene homolog, AP-1 and C-FOS and p55, FOS and IDBG-12957 and ENSG00000170345 and 2353, R-SMAD binding, nuclei, Fos and IDBG-158538 and ENSMUSG00000021250 and 14281, FOS and IDBG-646869 and ENSBTAG00000004322 and 280795
Gene info
  • Identity
  • Gene
    FOS
  • Long gene name
    Fos proto-oncogene, AP-1 transcription factor subunit
  • Synonyms gene name
    • v-fos FBJ murine osteosarcoma viral oncogene homolog
    • FBJ murine osteosarcoma viral oncogene homolog
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    2001-06-22
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • Fos transcription factor family
    • Basic leucine zipper proteins
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee