ATG12 cloning plasmid
-
Catalog numberCSB-CL002283HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the ATG12 gene.
-
SpecificationsGene name: ATG12; Gene ID: 9140; Accession number: BC011033; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 225; Sequence: atggcggaggagccgcagtctgtgttgcagcttcctacttcaattgctgctggaggggaaggacttacggatgtctccccagaaacaaccaccccggagcccccgtcttccgctgcagtttccccgggaacagaggaacctgctggcgacaccaagaaaaaaatttatttatgtgaatcagtcctttgctccttccccagaccaagaagttggaactctctatga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolATG12
-
Short nameATG12 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameATG12 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameautophagy related 12
-
Synonyms gene
-
Synonyms gene name
- Apg12 (autophagy 12, S. cerevisiae)-like
- APG12 autophagy 12-like (S. cerevisiae)
- ATG12 autophagy related 12 homolog (S. cerevisiae)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-10-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Autophagy related
-
VEGA ID