CTSW cloning plasmid

• Catalog number
  CSB-CL006205HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the CTSW gene.
• Specifications
  Gene name: CTSW; Gene ID: 1521; Accession number: BC048255; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1131; Sequence: atggcactgactgcccacccctcctgcctcctggccctgttggtggcaggcctagcccaaggcatcagaggcccccttagggcccaggacctaggtccccagccgctagagctgaaagaggccttcaagttgttccagatccagttcaaccggagttacctgagcccagaagagcatgctcaccgcctggacatctttgcccacaacctggcccaggctcagaggctgcaggaggaggacttgggcacagctgagtttggggtgactccattcagtgacctcacagaggaggagtttggccagctctatggctatcggagggcagctggaggggtccccagcatgggcagagaaataaggtctgaagagccagaggagtcagtacctttcagctgtgactggcggaaggtggccggcgccatctcacccatcaaggaccagaaaaactgcaactgctgctgggccatggcagcggcaggcaacatagagaccctgtggcgcatcagtttctgggattttgtggacgtctccgtgcaggaactgctggactgtggccgctgtggggatggctgccacggtggcttcgtctgggacgcgttcataactgtcctcaacaacagcggcctggccagtgaaaaggactacccgttccagggcaaagtcagagcccacaggtgccaccccaagaagtaccagaaggtggcctggatccaggacttcatcatgctgcagaacaacgagcacagaattgcgcagtacctggccacttatggccccatcaccgtgaccatcaacatgaagccccttcagctataccggaaaggtgtgatcaaggccacacccaccacctgtgacccccagcttgtggaccactctgtcctgctggtgggttttggcagcgtcaagtcagaggaggggatatgggcagagacagtctcatcgcagtctcagcctcagcctccacaccccaccccatactggatcctgaagaactcctggggggcccaatggggagagaagggctatttccggctgcaccgagggagcaatacctgtggcatcaccaagttcccgctcactgcccgtgtgcagaaaccggatatgaagccccgagtctcctgccctccctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  CTSW   cloning  
• Gene symbol
  CTSW
• Short name
  CTSW cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  cathepsin W cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  cathepsin W, LYPN, CTSW and IDBG-57946 and ENSG00000172543 and 1521, cysteine-type peptidase activity, Plasma membranes, Ctsw and IDBG-131698 and ENSMUSG00000024910 and 13041, CTSW and IDBG-644277 and ENSBTAG00000020773 and 510967

Gene info

• Identity
  HGNC:2546
• Gene
  CTSW
• Long gene name
  cathepsin W
• Synonyms gene name
  • cathepsin W (lymphopain)
• GenBank acession
  • AF055903
• Locus
  11q13.1
• Discovery year
  1997-06-12
• Entrez gene record
  1521
• Pubmed identfication
  • 9108299
  • 9675123
• RefSeq identity
  • NM_001335
• Classification
  • Cathepsins
• VEGA ID
  OTTHUMG00000166663

Similar products