LIAS cloning plasmid

• Catalog number
  CSB-CL012927HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the LIAS gene.
• Specifications
  Gene name: LIAS; Gene ID: 11019; Accession number: BC023635; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1119; Sequence: atgtctctacgctgcggggatgcagcccgcaccctggggccccgggtatttgggagatatttttgcagcccagtcagaccgttaagctccttgccagataaaaaaaaggaactcctacagaatggaccagaccttcaagattttgtatctggtgatcttgcagacaggagcacctgggatgaatataaaggaaacctaaaacgccagaaaggagaaaggttaagactacctccatggctaaagacagagattcccatggggaaaaattacaataaactgaaaaatactttgcggaatttaaatctccatacagtatgtgaggaagctcgatgtcccaatattggagagtgttggggaggtggagaatatgccaccgccacagccacgatcatgttgatgggtgacacatgtacaagaggttgcagattttgttctgttaagactgcaagaaatcctcctccactggatgccagtgagccctacaatactgcaaaggcaattgcagaatggggtctggattatgttgtcctgacatctgtggatcgagatgatatgcctgatgggggagctgaacacattgcaaagaccgtatcatatttaaaggaaaggaatccaaaaatccttgtggagtgtcttactcctgattttcgaggtgatctcaaagcaatagaaaaagttgctctgtcaggattagatgtgtatgcacataatgtagaaacagtcccggaattacagagtaaggttcgtgatcctcgggtcaattttgatcagtccctacgtgtactgaaacatgccaagaaggttcagcctgatgttatttctaaaacatctataatgttgggtttaggcgagaatgatgagcaagtatatgcaacaatgaaagcacttcgtgaggcagatgtagactgcttgactttaggacaatatatgcagccaacaaggcgtcaccttaaggttgaagaatatattactcctgaaaaattcaaatactgggaaaaagtaggaaatgaacttggatttcattatactgcaagtggccctttggtgcgttcttcatataaagcaggtgaatttttcctgaaaaatctagtggctaaaagaaaaacaaaagacctctaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  LIAS   cloning  
• Gene symbol
  LIAS
• Short name
  LIAS cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  lipoic acid synthetase cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  lipoic acid synthetase, LAS and LIP1 and LS and PDHLD, LIAS and IDBG-14368 and ENSG00000121897 and 11019, 4 iron, multiple, Lias and IDBG-166563 and ENSMUSG00000029199 and 79464, LIAS and IDBG-641738 and ENSBTAG00000014520 and 530865

Gene info

• Identity
  HGNC:16429
• Gene
  LIAS
• Long gene name
  lipoic acid synthetase
• Synonyms
  • LAS
• Synonyms name
  • Lipoyl synthase, mitochondrial
• GenBank acession
  • AJ224162
• Locus
  4p14
• Discovery year
  2001-11-30
• Entrez gene record
  11019
• Pubmed identfication
  • 11124703
• RefSeq identity
  • NM_194451
• Classification
  • Radical S-adenosylmethionine domain containing
• VEGA ID
  OTTHUMG00000099369

Similar products