RAC2 cloning plasmid
-
Catalog numberCSB-CL019248HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the RAC2 gene.
-
SpecificationsGene name: RAC2; Gene ID: 5880; Accession number: BC001485; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 579; Sequence: atgcaggccatcaagtgtgtggtggtgggagatggggccgtgggcaagacctgccttctcatcagctacaccaccaacgcgtttcccggagagtacatccccaccgtgtttgacaactattcagccaatgtgatggtggacagcaagccagtgaacctggggctgtgggacactgctgggcaggaggactacgaccgtctccggccgctctcctatccacagacggacgtcttcctcatctgcttctccctcgtcagcccagcctcttatgagaacgtccgcgccaagtggttcccagaagtgcggcaccactgccccagcacacccatcatcctggtgggcaccaagctggacctgcgggacgacaaggacaccatcgagaaactgaaggagaagaagctggctcccatcacctacccgcagggcctggcactggccaaggagattgactcggtgaaatacctggagtgctcagctctcacccagagaggcctgaaaaccgtgttcgacgaggccatccgggccgtgctgtgccctcagcccacgcggcagcagaagcgcgcctgcagcctcctctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolRAC2
-
Short nameRAC2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameras-related complement component 3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2), EN-7 and Gx and HSPC022 and p21-Rac2, RAC2 and IDBG-6499 and ENSG00000128340 and 5880, GTP binding, nuclei, Rac2 and IDBG-159514 and ENSMUSG00000033220 and 19354, RAC2 and IDBG-638195 and ENSBTAG00000011043 and 327671
-
Gene info
-
Identity
-
Gene
-
Long gene nameRac family small GTPase 2
-
Synonyms gene name
- ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1993-11-05
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Rho family GTPases
- Receptor ligands
-
VEGA ID
-
Locus Specific Databases