TGFBR2 cloning plasmid
-
Catalog numberCSB-CL023452HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TGFBR2 gene.
-
SpecificationsGene name: TGFBR2; Gene ID: 7048; Accession number: BC040499; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1005; Sequence: atgggtcgggggctgctcaggggcctgtggccgctgcacatcgtcctgtggacgcgtatcgccagcacgatcccaccgcacgttcagaagtcggttaataacgacatgatagtcactgacaacaacggtgcagtcaagtttccacaactgtgtaaattttgtgatgtgagattttccacctgtgacaaccagaaatcctgcatgagcaactgcagcatcacctccatctgtgagaagccacaggaagtctgtgtggctgtatggagaaagaatgacgagaacataacactagagacagtttgccatgaccccaagctcccctaccatgactttattctggaagatgctgcttctccaaagtgcattatgaaggaaaaaaaaaagcctggtgagactttcttcatgtgttcctgtagctctgatgagtgcaatgacaacatcatcttctcagaagaatataacaccagcaatcctgacttgttgctagtcatatttcaagtgacaggcatcagcctcctgccaccactgggagttgccatatctgtcatcatcatcttctactgctaccgcgttaaccggcagcagaagctgagttcaacctgggaaaccggcaagacgcggaagctcatggagttcagcgagcactgtgccatcatcctggaagatgaccgctctgacatcagctccacgtgtgccaacaacatcaaccacaacacagagctgctgcccattgagctggacaccctggtggggaaaggtcgctttgctgaggtctataaggccaagctgaagcagaacacttcagagcagtttgagacagtggcagtcaagatctttccctatgaggagtatgcctcttggaagacagagaaggacatcttctcagacatcaatctgaagcatgagaacatactccagttcctgacggctgaggagcggaagacggagttggggaaacaatactggctgatcaccgccttccacgccaagggcaacctacagtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTGFBR2
-
Short nameTGFBR2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametransforming growth factor, b receptor II (70/80kDa) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettransforming growth factor, beta receptor II (70/80kDa), AAT3 and FAA3 and LDS1B and LDS2 and LDS2B and MFS2 and RIIC and TAAD2 and TGFbeta-RII and TGFR-2, TGFBR2 and IDBG-23359 and ENSG00000163513 and 7048, transforming growth factor beta receptor activity, Cell surfaces, Tgfbr2 and IDBG-203902 and ENSMUSG00000032440 and 21813, BT.66001 and IDBG-644071 and ENSBTAG00000019832 and 535376
-
Gene info
-
Identity
-
Gene
-
Long gene nametransforming growth factor beta receptor 2
-
Synonyms gene
-
Synonyms gene name
- transforming growth factor, beta receptor II (70/80kDa)
- transforming growth factor beta receptor II
-
Synonyms
-
Locus
-
Discovery year1993-09-30
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Type 2 receptor serine/threonine kinases
-
VEGA ID
-
Locus Specific Databases