SYS1 cloning plasmid
-
Catalog numberCSB-CL836650HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SYS1 gene.
-
SpecificationsGene name: SYS1; Gene ID: 90196; Accession number: BC048286; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 471; Sequence: atggcgggtcagttccgcagctacgtgtgggacccgctgctgatcctgtcgcagatcgtcctcatgcagaccgtgtattacggctcgctgggcctgtggctggcgctggtggacgggctagtgcgaagcagcccctcgctggaccagatgttcgacgccgagatcctgggcttttccacccctccaggccggctctccatgatgtccttcatcctcaacgccctcacctgtgccctgggcttgctgtacttcatccggcgaggaaagcagtgtctggatttcactgtcactgtccatttctttcacctcctgggctgctggttctacagctcccgtttcccctcggcgctgacctggtggctggtccaagccgtgtgcattgcactcatggctgtcatcggggagtacctgtgcatgcggacggagctcaaggagatacccctcaactcagcccctaaatccaatgtctag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSYS1-DBNDD2, SYS1
-
Short nameSYS1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameSYS1 cloning plasmid
-
Alternative techniqueplasmids
-
Gene info
-
Identity
-
Gene
-
Long gene nameSYS1-DBNDD2 readthrough (NMD candidate)
-
Synonyms gene name
- SYS1-DBNDD2 readthrough (non-protein coding)
-
GenBank acession
-
Locus
-
Discovery year2011-05-31
-
Entrez gene record
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameSYS1 golgi trafficking protein
-
Synonyms gene
-
Synonyms gene name
- chromosome 20 open reading frame 169
- SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)
- Sys1 golgi trafficking protein
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-07-17
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID