NPHP1 cloning plasmid
-
Catalog numberCSB-CL015985HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NPHP1 gene.
-
SpecificationsGene name: NPHP1; Gene ID: 4867; Accession number: BC009789; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 366; Sequence: atgctggcgagacgacagcgagatcctctccaggccctgcggcgccgcaatcaggagctgaagcaacaggttgatagtttgctttctgagagccaactgaaagaagctctagaacccaataaaagacaacatatttatcaaagatgtatccagttaaagcaggcaatagatgaaaataaaaatgctcttcaaaaattaagcaaagctgatgaatctgcacctgttgcaaactataatcagagaaaagaagaggagcatactcttttggacaagcttacccaacaactgcagggccttgctgtgacaataagcagagaaaatataactgagtatgcttcctttctacctttcttttttcttttttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNPHP1
-
Short nameNPHP1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namenephronophthisis 1 (juvenile) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetnephronophthisis 1 (juvenile), JBTS4 and NPH1 and SLSN1, NPHP1 and IDBG-65479 and ENSG00000144061 and 4867, protein binding, Cell surfaces, Nphp1 and IDBG-205088 and ENSMUSG00000027378 and 53885, NPHP1 and IDBG-629033 and ENSBTAG00000007675 and 505421
-
Gene info
-
Identity
-
Gene
-
Long gene namenephrocystin 1
-
Synonyms gene
-
Synonyms gene name
- nephronophthisis 1 (juvenile)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1991-08-08
-
Entrez gene record
-
RefSeq identity
-
Classification
- NPHP complex
-
VEGA ID