WISP2 cloning plasmid

• Catalog number
  CSB-CL026120HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the WISP2 gene.
• Specifications
  Gene name: WISP2; Gene ID: 8839; Accession number: BC064379; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 753; Sequence: atgagaggcacaccgaagacccacctcctggccttctccctcctctgcctcctctcaaaggtgcgtacccagctgtgcccgacaccatgtacctgcccctggccacctccccgatgcccgctgggagtacccctggtgctggatggctgtggctgctgccgggtatgtgcacggcggctgggggagccctgcgaccaactccacgtctgcgacgccagccagggcctggtctgccagcccggggcaggacccggtggacggggggccctgtgcctcttggcagaggacgacagcagctgtgaggtgaacggccgcctgtatcgggaaggggagaccttccagccccactgcagcatccgctgccgctgcgaggacggcggcttcacctgcgtgccgctgtgcagcgaggatgtgcggctgcccagctgggactgcccccaccccaggagggtcgaggtcctgggcaagtgctgccctgagtgggtgtgcggccaaggagggggactggggacccagccccttccagcccaaggaccccagttttctggccttgtctcttccctgccccctggtgtcccctgcccagaatggagcacggcctggggaccctgctcgaccacctgtgggctgggcatggccacccgggtgtccaaccagaaccgcttctgccgactggagacccagcgccgcctgtgcctgtccaggccctgcccaccctccaggggtcgcagtccacaaaacagtgccttctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  WISP2   cloning  
• Gene symbol
  CCN5
• Short name
  WISP2 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  wingless-type MMTV integration site family, member 1 inducible signaling pathway protein 2 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  WNT1 inducible signaling pathway protein 2, CCN5 and CT58 and CTGF-L, WISP2 and IDBG-76864 and ENSG00000064205 and 8839, insulin-like growth factor binding, Extracellular, Wisp2 and IDBG-211971 and ENSMUSG00000027656 and 22403, WISP2 and IDBG-642819 and ENSBTAG00000006037 and 534658

Gene info

• Identity
  HGNC:12770
• Gene
  CCN5
• Long gene name
  cellular communication network factor 5
• Synonyms gene
  • WISP2
• Synonyms gene name
  • WNT1 inducible signaling pathway protein 2
• Synonyms
  • CT58
  • CTGF-L
  • WISP-2
• GenBank acession
  • AF100780
• Locus
  20q13.12
• Discovery year
  1999-01-22
• Entrez gene record
  8839
• Pubmed identfication
  • 9843955
• RefSeq identity
  • NM_003881
• Classification
  • Cellular communication network factors
• VEGA ID
  OTTHUMG00000033071

Similar products