FCER1A cloning plasmid
-
Catalog numberCSB-CL008532HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the FCER1A gene.
-
SpecificationsGene name: FCER1A; Gene ID: 2205; Accession number: BC005912; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 774; Sequence: atggctcctgccatggaatcccctactctactgtgtgtagccttactgttcttcgctccagatggcgtgttagcagtccctcagaaacctaaggtctccttgaaccctccatggaatagaatatttaaaggagagaatgtgactcttacatgtaatgggaacaatttctttgaagtcagttccaccaaatggttccacaatggcagcctttcagaagagacaaattcaagtttgaatattgtgaatgccaaatttgaagacagtggagaatacaaatgtcagcaccaacaagttaatgagagtgaacctgtgtacctggaagtcttcagtgactggctgctccttcaggcctctgctgaggtggtgatggagggccagcccctcttcctcaggtgccatggttggaggaactgggatgtgtacaaggtgatctattataaggatggtgaagctctcaagtactggtatgagaaccacaacatctccattacaaatgccacagttgaagacagtggaacctactactgtacgggcaaagtgtggcagctggactatgagtctgagcccctcaacattactgtaataaaagctccgcgtgagaagtactggctacaattttttatcccattgttggtggtgattctgtttgctgtggacacaggattatttatctcaactcagcagcaggtcacatttctcttgaagattaagagaaccaggaaaggcttcagacttctgaacccacatcctaagccaaaccccaaaaacaactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolFCER1A
-
Short nameFCER1A cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namefragment c fragment on immunoglobuline E, high affinity I, receptor to measure; a polypeptide cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetFc fragment of IgE, high affinity I, receptor for; alpha polypeptide, FCE1A and FcERI, FCER1A and IDBG-103887 and ENSG00000179639 and 2205, IgE binding, Cell surfaces, Fcer1a and IDBG-205782 and ENSMUSG00000005339 and 14125, FCER1A and IDBG-630768 and ENSBTAG00000012887 and 506783
-
Gene info
-
Identity
-
Gene
-
Long gene nameFc fragment of IgE receptor Ia
-
Synonyms gene
-
Synonyms gene name
- Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1989-06-30
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Immunoglobulin like domain containing
-
VEGA ID