NDRG1 cloning plasmid

• Catalog number
  CSB-CL835678HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NDRG1 gene.
• Specifications
  Gene name: NDRG1; Gene ID: 10397; Accession number: BC006260; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 330; Sequence: atggcggactgtggcggcctcccgcagatctcccagccggccaagctcgctgaggccttcaagtacttcgtgcagggcatgggatacatgccctcggctagcatgacccgcctgatgcggtcccgcacagcctctggttccagcgtcacttctctggatggcacccgcagccgctcccacaccagcgagggcacccgaagccgctcccacaccagcgagggcacccgcagccgctcgcacaccagcgagggggcccacctggacatcacccccaactcgggtgctgctgggaacagcgccgggcccaagtccatggaggtctcctgctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NDRG1   cloning  
• Gene symbol
  NDRG1
• Short name
  NDRG1 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  N-v-myc myelocytomatosis viral oncogene homolog (avian) downstream regulated 1 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  N-myc downstream regulated 1, CAP43 and CMT4D and DRG-1 and DRG1 and GC4 and HMSNL and NDR1 and NMSL and PROXY1 and RIT42 and RTP and TARG1 and TDD5, NDRG1 and IDBG-36420 and ENSG00000104419 and 10397, cadherin binding, nuclei, Ndrg1 and IDBG-146853 and ENSMUSG00000005125 and 17988, NDRG1 and IDBG-644056 and ENSBTAG00000000711 and 504499

Gene info

• Identity
  HGNC:7679
• Gene
  NDRG1
• Long gene name
  N-myc downstream regulated 1
• Synonyms gene
  • CAP43
• Synonyms
  • DRG1
  • RTP
  • TDD5
  • NDR1
• GenBank acession
  • X92845
• Locus
  8q24.22
• Discovery year
  1998-12-23
• Entrez gene record
  10397
• Pubmed identfication
  • 9251681
  • 8939898
  • 18455888
• Classification
  • NDRG family
• VEGA ID
  OTTHUMG00000164441
• Locus Specific Databases
  • Inherited Peripheral Neuropathies Mutation Database
  • LRG_258

Similar products