PPIF cloning plasmid
-
Catalog numberCSB-CL018476HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PPIF gene.
-
SpecificationsGene name: PPIF; Gene ID: 10105; Accession number: BC005020; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 624; Sequence: atgctggcgctgcgctgcggctcccgctggctcggcctgctctccgtcccgcgctccgtgccgctgcgcctccccgcggcccgcgcctgcagcaagggctccggcgacccgtcctcttcctcctcctccgggaacccgctcgtgtacctggacgtggacgccaacgggaagccgctcggccgcgtggtgctggagctgaaggcagatgtcgtcccaaagacagctgagaacttcagagccctgtgcactggtgagaagggcttcggctacaaaggctccaccttccacagggtgatcccttccttcatgtgccaggcgggcgacttcaccaaccacaatggcacaggcgggaagtccatctacggaagccgctttcctgacgagaactttacactgaagcacgtggggccaggtgtcctgtccatggctaatgctggtcctaacaccaacggctcccagttcttcatctgcaccataaagacagactggttggatggcaagcatgttgtgttcggtcacgtcaaagagggcatggacgtcgtgaagaaaatagaatctttcggctctaagagtgggaggacatccaagaagattgtcatcacagactgtggccagttgagctaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPPIF
-
Short namePPIF cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namepeptidylprolyl isomerase F cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetpeptidylprolyl isomerase F, Cyp-D and CyP-M and CYP3 and CypD, PPIF and IDBG-79997 and ENSG00000108179 and 10105, peptide binding, Plasma membranes, Ppif and IDBG-138877 and ENSMUSG00000021868 and 105675, PPIF and IDBG-630958 and ENSBTAG00000016711 and 414346
-
Gene info
-
Identity
-
Gene
-
Long gene namepeptidylprolyl isomerase F
-
Synonyms gene name
- peptidylprolyl isomerase F (cyclophilin F)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-06-02
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Cyclophilin peptidylprolyl isomerases
-
VEGA ID