DGCR8 cloning plasmid

• Catalog number
  CSB-CL845175HU1-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the DGCR8 gene.
• Specifications
  Gene name: DGCR8; Gene ID: 54487; Accession number: BC009984; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 915; Sequence: atggagacagatgagagcccctctccgctcccgtgtgggcccgcaggagaagcggtgatggagagccgagctcgccccttccaagcgctgccccgtgagcagtctccaccacctcccctgcaaacgtccagtggtgcagaggtaatggacgttggctctggtggtgatggacagtccgaactccctgctgaggaccccttcaacttctacggagcttctcttctctccaaaggatccttctctaagggccgcctcctcatagacccgaactgtagtggccacagcccgcgcaccgcccggcacgcacctgcggtccggaagttctcccctgaccttaagttgcttaaggatgtaaagattagcgtgagctttaccgagagctgcaggagtaaggacaggaaggtgctgtacacaggagcagagcgcgacgtgcgggcggagtgcggtctgctccttagccctgtcagtggggacgtgcatgcttgtccctttggcgggagtgttggtgacggggtaggcatagggggtgagagtgctgataagaaggatgaggagaatgagctggatcaggaaaagagagtggagtatgcagtgctcgatgagttagaagattttactgacaatttggagctagatgaagaaggagcaggcgggttcacggctaaagcaatcgttcagagagacagagtggatgaagaggccttgaatttcccctacgaggatgactttgacaacgatgtggatgctctgctggaagaaggcctttgtgcccccaaaaagaggcgaacagaggaaaaatatggcggagacagcgaccatccgtccgatggagagacaagtgtgcagccgatgatgaccaagattaaaacagtgctcaaaagtcgtggccgcccacctacagagcctgttctgtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  DGCR8   cloning  
• Gene symbol
  DGCR8
• Short name
  DGCR8 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  DiGeorge syndrome critical region gene 8 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  DiGeorge syndrome critical region gene 8, DGCR8 and IDBG-1583 and ENSG00000128191 and 100302197,54487, metal ion binding, nuclei, Dgcr8 and IDBG-141484 and ENSMUSG00000022718 and 94223, DGCR8 and IDBG-638235 and ENSBTAG00000019869 and 540254

Gene info

• Identity
  HGNC:2847
• Gene
  DGCR8
• Long gene name
  DGCR8 microprocessor complex subunit
• Synonyms gene
  • C22orf12
• Synonyms gene name
  • chromosome 22 open reading frame 12
  • DiGeorge syndrome critical region gene 8
  • DGCR8, microprocessor complex subunit
• Synonyms
  • DGCRK6
  • Gy1
  • pasha
• GenBank acession
  • AF165527
  • AB050770
• Locus
  22q11.21
• Discovery year
  2000-06-29
• Entrez gene record
  54487
• Pubmed identfication
  • 21454614
• Classification
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000150503

Similar products