CEBPE cloning plasmid
-
Catalog numberCSB-CL618016HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the CEBPE gene.
-
SpecificationsGene name: CEBPE; Gene ID: 1053; Accession number: BC035797; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 846; Sequence: atgtcccacgggacctactacgagtgtgagccccggggtggccagcagccactcgagttctcagggggccgagctgggcccggggagctaggggacatgtgtgagcatgaggcctccattgacctctccgcctacatcgagtctggggaagagcagcttctctccgatctctttgccgtgaagccagcgcctgaggccagaggcctcaagggccccggaacccctgccttcccccactacttgccgcctgaccctcggccctttgcctaccctccacataccttcggcccagacaggaaggcgctggggcctggcatctacagcagcccagggagctacgaccccagggctgtggcggtgaaggaggagccccgggggccagagggcagccgagctgccagccgaggcagctacaatcccctgcagtaccaagtggcacactgtgggcagacagccatgcacctgcccccaactctggcagcacccggccagcctctgcgcgttctcaaggcccctttggccactgccgcacccccctgcagtcccctcctgaaggcgccctccccggctggccccttacacaagggcaagaaggcagtgaacaaagatagccttgagtaccggctgaggcgggagcgcaacaacatcgccgtgcgcaagagccgagacaaggccaagaggcgcattctggagacgcagcagaaggtgctggagtacatggcagagaacgagcgcctccgcagccgcgtggagcagctcacccaggagctagacaccctccgcaacctcttccgccagattcctgaggcggccaacctcatcaagggcgtggggggttgcagctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCEBPE
-
Short nameCEBPE cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameCCAAT/enhancer binding protein (C/EBP), epsilon cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetCCAAT/enhancer binding protein (C/EBP), epsilon, C/EBP-epsilon and CRP1, CEBPE and IDBG-3098 and ENSG00000092067 and 1053, protein heterodimerization activity, nuclei, Cebpe and IDBG-162142 and ENSMUSG00000052435 and 110794, BT.87788 and IDBG-645830 and ENSBTAG00000005952 and 534346
-
Gene info
-
Identity
-
Gene
-
Long gene nameCCAAT enhancer binding protein epsilon
-
Synonyms gene name
- CCAAT/enhancer binding protein (C/EBP), epsilon
- CCAAT/enhancer binding protein epsilon
-
Synonyms
-
Locus
-
Discovery year1992-06-24
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Basic leucine zipper proteins
- CCAAT/enhancer binding proteins
-
VEGA ID
-
Locus Specific Databases