PTAFR cloning plasmid

• Catalog number
  CSB-CL018946HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the PTAFR gene.
• Specifications
  Gene name: PTAFR; Gene ID: 5724; Accession number: BC063000; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1029; Sequence: atggagccacatgactcctcccacatggactctgagttccgatacactctcttcccgattgtttacagcatcatctttgtgctcggggtcattgctaatggctacgtgctgtgggtctttgcccgcctgtacccttgcaagaaattcaatgagataaagatcttcatggtgaacctcaccatggcggacatgctcttcttgatcaccctgccactttggattgtctactaccaaaaccagggcaactggatactccccaaattcctgtgcaacgtggctggctgccttttcttcatcaacacctactgctctgtggccttcctgggcgtcatcacttataaccgcttccaggcagtaactcggcccatcaagactgctcaggccaacacccgcaagcgtggcatctctttgtccttggtcatctgggtggccattgtgggagctgcatcctacttcctcatcctggactccaccaacacagtgcccgacagtgctggctcaggcaacgtcactcgctgctttgagcattacgagaagggcagcgtgccagtcctcatcatccacatcttcatcgtgttcagcttcttcctggtcttcctcatcatcctcttctgcaacctggtcatcatccgtaccttgctcatgcagccggtgcagcagcagcgcaacgctgaagtcaagcgccgggcgctgtggatggtgtgcacggtcttggcggtgttcatcatctgcttcgtgccccaccacgtggtgcagctgccctggacccttgctgagctgggcttccaggacagcaaattccaccaggccattaatgatgcacatcaggtcaccctctgcctccttagcaccaactgtgtcttagaccctgttatctactgtttcctcaccaagaagttccgcaagcacctcaccgaaaagttctacagcatgcgcagtagccggaaatgctcccgggccaccacggatacggtcactgaagtggttgtgccattcaaccagatccctggcaattccctcaaaaattag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  PTAFR   cloning  
• Gene symbol
  PTAFR
• Short name
  PTAFR cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  platelet-activating factor receptor cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  platelet-activating factor receptor, PAFR, PTAFR and IDBG-95161 and ENSG00000169403 and 5724, phospholipid binding, Plasma membranes, Ptafr and IDBG-194111 and ENSMUSG00000056529 and 19204, PTAFR and IDBG-644951 and ENSBTAG00000027051 and 518283

Gene info

• Identity
  HGNC:9582
• Gene
  PTAFR
• Long gene name
  platelet activating factor receptor
• GenBank acession
  • BC063000
• Locus
  1p35.3
• Discovery year
  1991-11-14
• Entrez gene record
  5724
• Pubmed identfication
  • 1322356
• RefSeq identity
  • NM_000952
• Classification
  • Platelet activating factor receptor
• VEGA ID
  OTTHUMG00000003953

Similar products