SLC9A1 cloning plasmid

  • Catalog number
    CSB-CL021726HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the SLC9A1 gene.
  • Specifications
    Gene name: SLC9A1; Gene ID: 6548; Accession number: BC012121; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1668; Sequence: atggttctgcggtctggcatctgtggcctctctccacatcggatcttcccttccttactcgtggtggttgctttggtggggctgctgcctgttctcaggagccatggcctccagctcagcccaactgccagcaccattcgaagctcagagccaccacgagaacgctcgattggggatgtcaccaccgctccaccggaggtcaccccagagagccgccctgttaatcattccgtcactgatcatggcatgaagccgcgcaaggcctttccagtcctgggcatcgactacacacacgtgcgcacccccttcgagatctccctctggatccttctggcctgcctcatgaagataggtttccatgtgatccccactatctcaagcatcgtcccggagagctgcctgctgatcgtggtggggctgctggtggggggcctgatcaagggtgtaggcgagacaccccccttcctgcagtccgacgtcttcttcctcttcctgctgccgcccatcatcctggatgcgggctacttcctgccactgcggcagttcacagaaaacctgggcaccatcctgatctttgccgtggtgggcacgctgtggaacgccttcttcctgggcggcctcatgtacgccgtgtgcctggtgggcggtgagcagatcaacaacatcggcctcctggacaacctgctcttcggcagcatcatctcggccgtggaccccgtggcggttctggctgtctttgaggaaattcacatcaatgagctgctgcacatccttgtttttggggagtccttgctcaatgacgccgtcactgtggtcctgtatcacctctttgaggagtttgccaactacgaacacgtgggcatcgtggacatcttcctcggcttcctgagcttcttcgtggtggccctgggcggggtgcttgtgggcgtggtctacggggtcatcgcagccttcacctcccgatttacctcccacatccgggtcatcgagccgctcttcgtcttcctctacagctacatggcctacttgtcagccgagctcttccacctgtcaggcatcatggcgctcatagcctcaggagtggtgatgcgcccctatgtggaggccaacatctcccacaagtcccacaccaccatcaaatacttcctgaagatgtggagcagcgtcagcgagaccctcatcttcatcttcctcggcgtctccacggtggccggctcccaccactggaactggaccttcgtcatcagcaccctgctcttctgcctcatcgcccgcgtgctgggggtgctgggcctgacctggttcatcaacaagttccgtatcgtgaagctgacccccaaggaccagttcatcatcgcctatgggggcctgcgaggggccatcgccttctctctgggctacctcctggacaagaagcacttccccatgtgtgacctgttcctcactgccatcatcactgtcatcttcttcaccgtctttgtgcaggtgctgggccagggcagggcaggcccttgccttggggaccctcacaggctgttcccgtggaaagagaggaaagcgtgtgatttgaaatgcgattctagtcccagctccaccactaacttgctgtgtgaccttgggcgagccactccccctttctgggcctcagtttcttcaatcgtaaagtga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    SLC9A1   cloning  
  • Gene symbol
    SLC9A1
  • Short name
    SLC9A1 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1, APNH and NHE-1 and NHE1 and PPP1R143, SLC9A1 and IDBG-94809 and ENSG00000090020 and 6548, calcium-dependent protein binding, nuclei, Slc9a1 and IDBG-195032 and ENSMUSG00000028854 and 20544, SLC9A1 and IDBG-645084 and ENSBTAG00000008766 and 317654
Gene info
  • Identity
  • Gene
  • Long gene name
    solute carrier family 9 member A1
  • Synonyms gene
  • Synonyms gene name
    • solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)
    • solute carrier family 9 (sodium/hydrogen exchanger), member 1
    • solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1
  • Synonyms
  • Synonyms name
  • GenBank acession
  • Locus
  • Discovery year
    1986-01-01
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • Solute carriers
    • Protein phosphatase 1 regulatory subunits
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee