NUPR1 cloning plasmid
-
Catalog numberCSB-CL527662HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the NUPR1 gene.
-
SpecificationsGene name: NUPR1; Gene ID: 26471; Accession number: BC002434; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 249; Sequence: atggccaccttcccaccagcaaccagcgccccccagcagcccccaggcccggaggacgaggactccagcctggatgaatctgacctctatagcctggcccattcctacctcggaggtggaggccggaaaggtcgcaccaagagagaagctgctgccaacaccaaccgccccagccctggcgggcacgagaggaaactggtgaccaagctgcagaattcagagaggaagaagcgaggggcacggcgctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolNUPR1
-
Short nameNUPR1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namenuclear protein, transcriptional regulator, 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetnuclear protein, transcriptional regulator, 1, NUPR1 and IDBG-22854 and ENSG00000176046 and 26471, protein binding, nuclei, Nupr1 and IDBG-209683 and ENSMUSG00000030717 and 56312, NUPR1 and IDBG-639119 and ENSBTAG00000018016 and 614673
-
Gene info
-
Identity
-
Gene
-
Long gene namenuclear protein 1, transcriptional regulator
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2009-05-21
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID