PRKCH cloning plasmid
-
Catalog numberCSB-CL018706HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PRKCH gene.
-
SpecificationsGene name: PRKCH; Gene ID: 5583; Accession number: BC001000; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 126; Sequence: atggcactagaaatagttgataatgaaatgagattttatgaagtataccgctccacctatgagcgtctgtctctgtgggcttgggatgttaacaggagccaaaaggagggaaagtgtgaagaataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPRKCH-AS1, PRKCH
-
Short namePRKCH cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprotein kinase C, eta cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprotein kinase C, eta, nPKC-eta and PKC-L and PKCL and PRKCL, PRKCH and IDBG-8479 and ENSG00000027075 and 5583, transferase activity, Cell surfaces, Prkch and IDBG-148471 and ENSMUSG00000021108 and 18755, BT.22013 and IDBG-646756 and ENSBTAG00000003276 and 518542
-
Gene info
-
Identity
-
Gene
-
Long gene namePRKCH antisense RNA 1
-
Locus
-
Discovery year2021-04-28
-
Classification
- Antisense RNAs
Gene info
-
Identity
-
Gene
-
Long gene nameprotein kinase C eta
-
Synonyms gene
-
Synonyms gene name
- protein kinase C, eta
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1992-06-26
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- C2 domain containing protein kinases
- AGC family kinases
-
VEGA ID