EBI3 cloning plasmid

• Catalog number
  CSB-CL622759HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the EBI3 gene.
• Specifications
  Gene name: EBI3; Gene ID: 10148; Accession number: BC015364; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 690; Sequence: atgaccccgcagcttctcctggcccttgtcctctgggccagctgcccgccctgcagtggaaggaaagggcccccagcagctctgacactgccccgggtgcaatgccgagcctctcggtacccgatcgccgtggattgctcctggaccctgccgcctgctccaaactccaccagccccgtgtccttcattgccacgtacaggctcggcatggctgcccggggccacagctggccctgcctgcagcagacgccaacgtccaccagctgcaccatcacggatgtccagctgttctccatggctccctacgtgctcaatgtcaccgccgtccacccctggggctccagcagcagcttcgtgcctttcataacagagcacatcatcaagcccgaccctccagaaggcgtgcgcctaagccccctcgctgagcgccagctacaggtgcagtgggagcctcccgggtcctggcccttcccagagatcttctcactgaagtactggatccgttacaagcgtcagggagctgcgcgcttccaccgggtggggcccattgaagccacgtccttcatcctcagggctgtgcggccccgagccaggtactacgtccaagtggcggctcaggacctcacagactacggggaactgagtgactggagtctccccgccactgccacaatgagcctgggcaagtag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  EBI3   cloning  
• Gene symbol
  EBI3
• Short name
  EBI3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  Epstein-Barr virus induced 3 cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  Epstein-Barr virus induced 3, IL-27B and IL27B, EBI3 and IDBG-18580 and ENSG00000105246 and 10148, interleukin-27 receptor binding, Extracellular, Ebi3 and IDBG-191286 and ENSMUSG00000003206 and 50498, EBI3 and IDBG-644295 and ENSBTAG00000012829 and 514933

Gene info

• Identity
  HGNC:3129
• Gene
  EBI3
• Long gene name
  Epstein-Barr virus induced 3
• Synonyms
  • IL27B
  • IL35B
• Synonyms name
  • IL27 subunit
  • IL35 subunit
• GenBank acession
  • L08187
• Locus
  19p13.3
• Discovery year
  2000-05-02
• Entrez gene record
  10148
• Pubmed identfication
  • 8551575
• Classification
  • Fibronectin type III domain containing
  • Minor histocompatibility antigens
• VEGA ID
  OTTHUMG00000181866

Similar products