HLA-C cloning plasmid

  • Catalog number
    CSB-CL320739HU1-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the HLA-C gene.
  • Specifications
    Gene name: HLA-C; Gene ID: 3107; Accession number: BC008457; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1119; Sequence: atgcgggtcatggcgccccgaaccctcatcctgctgctctcgggagccctggccctgaccgagacctgggccggctcccactccatgaggtatttctacaccgctgtgtcccggcccggccgcggggagccccacttcatcgcagtgggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagtccgagaggggagccgcgggcgccgtgggtggagcaggaggggccggagtattgggaccgggagacacagaagtacaagcgccaggcacagactgaccgagtgagcctgcggaacctgcgcggctactacaaccagagcgaggccaggtctcacatcatccagaggatgtatggctgcgacgtggggcccgacgggcgcctcctccgcgggtatgaccagtacgcctacgacggcaaggattacatcgccctgaacgaggatctgcgctcctggaccgccgcggacacggcggctcagatcacccagcgcaagtgggaggcggcccgtgaggcggagcagctgagagcctacctggagggcctgtgcgtggagtggctccgcagatacctgaagaatgggaaggagacgctgcagcgcgcggaacacccaaagacacacgtgacccaccatcccgtctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagtgggatggggaggaccaaactcaggacactgagcttgtggagaccaggccagcaggagatggaaccttccagaagtgggcagctgtggtggtgccttctggagaagagcagagatacacgtgccatgtgcagcacgaggggctgccggagcccctcaccctgagatgggagccgtcttcccagcccaccatccccatcgtgggcatcgttgctggcctggctgtcctggctgtcctagctgtcctaggagctgtggtggctgttgtgatgtgtaggaggaagagctcagggcattttcttcccacaggtggaaaaggagggagctgctctcaggctgcgtccagcaacagtgcccagggctctgatgagtctctcatcgcttgtaaagcctga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    HLA-C   cloning  
  • Gene symbol
    HLA-C, HLA-DPA2, HLA-DOA, HLA-DQA1, HLA-N, HLA-DQA2, HLA-DPB1, HLA-DQB2, HLA-W, HLA-DRA
  • Short name
    HLA-C cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    major histocompatibility complex, class I, C cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    major histocompatibility complex, class I, C, D6S204 and HLA-JY3 and HLC-C and PSORS1, HLA-C and IDBG-77290 and ENSG00000204525 and 3107, peptide antigen binding, Cell surfaces
Gene info
Gene info
Gene info
Gene info
Gene info
Gene info
Gene info
Gene info
Gene info
Gene info
MeSH Data
  • Name
  • Concept
    Scope note: Testing erythrocytes to determine presence or absence of blood-group antigens, testing of serum to determine the presence or absence of antibodies to these antigens, and selecting biocompatible blood by crossmatching samples from the donor against samples from the recipient. Crossmatching is performed prior to transfusion.
  • Tree numbers
    • E01.370.225.625.120
    • E01.370.225.812.385.120
    • E05.200.625.120
    • E05.200.812.385.120
    • E05.478.594.385.120
  • Qualifiers
    ethics, mortality, psychology, trends, veterinary, history, classification, economics, instrumentation, methods, nursing, standards, adverse effects, statistics & numerical data
Similar products
Filters
Contact
Chat with gentaur.com employee