SPP1 cloning plasmid
-
Catalog numberCSB-CL022603HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SPP1 gene.
-
SpecificationsGene name: SPP1; Gene ID: 6696; Accession number: BC017387; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 945; Sequence: atgagaattgcagtgatttgcttttgcctcctaggcatcacctgtgccataccagttaaacaggctgattctggaagttctgaggaaaagcagctttacaacaaatacccagatgctgtggccacatggctaaaccctgacccatctcagaagcagaatctcctagccccacagaatgctgtgtcctctgaagaaaccaatgactttaaacaagagacccttccaagtaagtccaacgaaagccatgaccacatggatgatatggatgatgaagatgatgatgaccatgtggacagccaggactccattgactcgaacgactctgatgatgtagatgacactgatgattctcaccagtctgatgagtctcaccattctgatgaatctgatgaactggtcactgattttcccacggacctgccagcaaccgaagttttcactccagttgtccccacagtagacacatatgatggccgaggtgatagtgtggtttatggactgaggtcaaaatctaagaagtttcgcagacctgacatccagtaccctgatgctacagacgaggacatcacctcacacatggaaagcgaggagttgaatggtgcatacaaggccatccccgttgcccaggacctgaacgcgccttctgattgggacagccgtgggaaggacagttatgaaacgagtcagctggatgaccagagtgctgaaacccacagccacaagcagtccagattatataagcggaaagccaatgatgagagcaatgagcattccgatgtgattgatagtcaggaactttccaaagtcagccgtgaattccacagccatgaatttcacagccatgaagatatgctggttgtagaccccaaaagtaaggaagaagataaacacctgaaatttcgtatttctcatgaattagatagtgcatcttctgaggtcaattaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSPP1, CXXC1
-
Short nameSPP1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namesecreted phosphoprotein 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetsecreted phosphoprotein 1, BNSP and BSPI and ETA-1 and OPN, SPP1 and IDBG-29322 and ENSG00000118785 and 6696, extracellular matrix binding, Extracellular, Spp1 and IDBG-185485 and ENSMUSG00000029304 and 20750, SPP1 and IDBG-641200 and ENSBTAG00000005260 and 281499
-
Gene info
-
Identity
-
Gene
-
Long gene namesecreted phosphoprotein 1
-
Synonyms gene
-
Synonyms gene name
- osteopontin
- bone sialoprotein I
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year1989-03-06
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Receptor ligands
- SIBLING family
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameCXXC finger protein 1
-
Synonyms gene name
- CXXC finger 1 (PHD domain)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-02-18
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Zinc fingers CXXC-type
- PHD finger proteins
-
VEGA ID