TROAP cloning plasmid
-
Catalog numberCSB-CL618632HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TROAP gene.
-
SpecificationsGene name: TROAP; Gene ID: 10024; Accession number: BC011597; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 435; Sequence: atgaccacccggcaagccacgaaggatcccctcctccggggtgtatctcctacccctagcaagattccggtacgctctcagaaacgcacgcctttccccactgttacatcgtgcgccgtggaccaggagaaccaagatccaaggagatgggtgcagaaaccaccgctcaatattcaacgccccctcgttgattcagcaggccccaggccgaaagccaggcaccaggcagagacatcacaaagattggtggggatcagtcagcctcggaaccccttggaagagctcaggcctagccctaggggtcaaaatgtggggcctgggccccctgcccagacagtcctggtcccagctcctggaaagctctttgctcttagaagatctccctttcctccagcaaaatgtcatctcgccaggtgccatggcttgtacctgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTROAP, TROAP-AS1
-
Short nameTROAP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametrophinin associated protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettrophinin associated protein, TASTIN, TROAP and IDBG-31395 and ENSG00000135451 and 10024, protein binding, Cytoplasm, Troap and IDBG-182185 and ENSMUSG00000032783 and 78733, TROAP and IDBG-632605 and ENSBTAG00000008499 and 505791
-
Gene info
-
Identity
-
Gene
-
Long gene nametrophinin associated protein
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2000-04-13
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameTROAP and PRPH antisense RNA 1
-
Locus
-
Discovery year2021-01-20
-
Entrez gene record
-
RefSeq identity
-
Classification
- Antisense RNAs