BDNF cloning plasmid
-
Catalog numberCSB-CL002655HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the BDNF gene.
-
SpecificationsGene name: BDNF; Gene ID: 627; Accession number: BC029795; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 744; Sequence: atgaccatccttttccttactatggttatttcatactttggttgcatgaaggctgcccccatgaaagaagcaaacatccgaggacaaggtggcttggcctacccaggtgtgcggacccatgggactctggagagcgtgaatgggcccaaggcaggttcaagaggcttgacatcattggctgacactttcgaacacatgatagaagagctgttggatgaggaccagaaagttcggcccaatgaagaaaacaataaggacgcagacttgtacacgtccagggtgatgctcagtagtcaagtgcctttggagcctcctcttctctttctgctggaggaatacaaaaattacctagacgctgcaaacatgtccatgagggtccggcgccactctgaccctgcccgccgaggggagctgagcgtgtgtgacagtattagtgagtgggtaacggcggcagacaaaaagactgcagtggacatgtcgggcgggacggtcacagtccttgaaaaggtccctgtatcaaaaggccaactgaagcaatacttctacgagaccaagtgcaatcccatgggttacacaaaagaaggctgcaggggcatagacaaaaggcattggaactcccagtgccgaactacccagtcgtacgtgcgggcccttaccatggatagcaaaaagagaattggctggcgattcataaggatagacacttcttgtgtatgtacattgaccattaaaaggggaagatag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolBDNF, BDNF-AS
-
Short nameBDNF cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namebrain-derived neurotrophic factor cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetbrain-derived neurotrophic factor, ANON2 and BULN2, BDNF and IDBG-36817 and ENSG00000176697 and 627, growth factor activity, Extracellular, Bdnf and IDBG-195506 and ENSMUSG00000048482 and 12064, BDNF and IDBG-636102 and ENSBTAG00000008134 and 617701
-
Gene info
-
Identity
-
Gene
-
Long gene namebrain derived neurotrophic factor
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1991-01-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Neurotrophins
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameBDNF antisense RNA
-
Synonyms gene
-
Synonyms gene name
- BDNF opposite strand (non-protein coding)
- BDNF antisense RNA (non-protein coding)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2005-02-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Antisense RNAs