PBX3 cloning plasmid

  • Catalog number
    CSB-CL017507HU-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the PBX3 gene.
  • Specifications
    Gene name: PBX3; Gene ID: 5090; Accession number: BC016977; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 825; Sequence: atgaaccttctccgagaacagagtagaacacgtcccatttctccaaaagagattgaaagaatggtgggcatcatccatcgaaaatttagttccattcagatgcagctcaaacaaagcacttgtgaagcagttatgattttaagatcaaggttccttgatgccagacggaaaaggcgtaacttcagtaaacaggccacagaaatcttgaatgaatatttttactcacacctcagcaacccctaccccagtgaagaagccaaagaggagctggccaagaaatgcagcatcacagtgtcacagagtcttgtaaaggatccaaaagaaagagggagcaaaggttctgacatccagccaactagcgtggtatccaattggtttggcaacaaacgaatcaggtacaagaagaacattggcaagtttcaggaagaagccaacctctatgctgcaaagacggccgtgacagctgcacacgcagtagcagcagctgtgcagaacaaccagaccaattcgcccaccacaccaaattccggttcttctggttcttttaacctcccaaattctggggacatgttcatgaacatgcagagtctgaatggggattcttaccaagggtcccaagtcggagccaatgtgcaatcacaggtggataccctccgtcatgttatcaatcagacgggaggctacagtgatggccttggaggaaattcactgtacagtccacataatttaaatgctaatggaggctggcaggacgcaacaactccatcttctgtgacttctcctacagaaggcccaggaagtgtgcactcggatacctctaactaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    PBX3   cloning  
  • Gene symbol
    PBX3, PBX3-DT
  • Short name
    PBX3 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    pre-B-cell leukemia homeobox 3 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    pre-B-cell leukemia homeobox 3, PBX3 and IDBG-85327 and ENSG00000167081 and 5090, sequence-specific DNA binding, nuclei, Pbx3 and IDBG-162874 and ENSMUSG00000038718 and 18516, BT.74403 and IDBG-638772 and ENSBTAG00000013314 and 539222
Gene info
  • Identity
  • Gene
  • Long gene name
    PBX homeobox 3
  • Synonyms gene name
    • pre-B-cell leukemia transcription factor 3
    • pre-B-cell leukemia homeobox 3
  • Locus
  • Discovery year
    1990-09-10
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • TALE class homeoboxes and pseudogenes
  • VEGA ID
Gene info
  • Identity
  • Gene
  • Long gene name
    PBX3 divergent transcript
  • Locus
  • Discovery year
    2021-07-28
  • Entrez gene record
  • RefSeq identity
  • Classification
    • Divergent transcripts
Similar products
Filters
Contact
Chat with gentaur.com employee