IGJ cloning plasmid

• Catalog number
  CSB-CL011337HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the IGJ gene.
• Specifications
  Gene name: IGJ; Gene ID: 3512; Accession number: BC038982; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 480; Sequence: atgaagaaccatttgcttttctggggagtcctggcggtttttattaaggctgttcatgtgaaagcccaagaagatgaaaggattgttcttgttgacaacaaatgtaagtgtgcccggattacttccaggatcatccgttcttccgaagatcctaatgaggacattgtggagagaaacatccgaattattgttcctctgaacaacagggagaatatctctgatcccacctcaccattgagaaccagatttgtgtaccatttgtctgacctctgtaaaaaatgtgatcctacagaagtggagctggataatcagatagttactgctacccagagcaatatctgtgatgaagacagtgctacagagacctgctacacttatgacagaaacaagtgctacacagctgtggtcccactcgtatatggtggtgagaccaaaatggtggaaacagccttaaccccagatgcctgctatcctgactaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  IGJ   cloning  
• Gene symbol
  JCHAIN
• Short name
  IGJ cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides, IGCJ and JCH, IGJ and IDBG-22626 and ENSG00000132465 and 3512, peptidoglycan binding, Extracellular, Igj and IDBG-177206 and ENSMUSG00000067149 and 16069, IGJ and IDBG-642895 and ENSBTAG00000018531 and 280821

Gene info

• Identity
  HGNC:5713
• Gene
  JCHAIN
• Long gene name
  joining chain of multimeric IgA and IgM
• Synonyms gene
  • IGJ
• Synonyms gene name
  • immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
• Synonyms
  • IGCJ
  • JCH
• Synonyms name
  • immunoglobulin J chain
  • IgJ chain
  • J chain
• GenBank acession
  • M12759
• Locus
  4q13.3
• Discovery year
  2001-06-22
• Entrez gene record
  3512
• Pubmed identfication
  • 3016707
  • 2984306
• RefSeq identity
  • NM_144646
• VEGA ID
  OTTHUMG00000129909

Similar products