PRKCDBP cloning plasmid
-
Catalog numberCSB-CL842624HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PRKCDBP gene.
-
SpecificationsGene name: PRKCDBP; Gene ID: 112464; Accession number: BC011585; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 786; Sequence: atgagggagagtgcgttggagccggggcctgtgcccgaggcgccggcggggggtcccgtgcacgccgtgacggtggtgaccctgctggagaagctggcctccatgctggagactctgcgggagcggcagggaggcctggctcgaaggcagggaggcctggcagggtccgtgcgccgcatccagagcggcctgggcgctctgagtcgcagccacgacaccaccagcaacaccttggcgcagctgctggccaaggcggagcgcgtgagctcgcacgccaacgccgcccaagagcgcgcggtgcgccgcgcagcccaggtgcagcggctggaggccaaccacgggctgctggtggcgcgcgggaagctccacgttctgctcttcaaggaggagggtgaagtcccagccagcgctttccagaaggcaccagagcccttgggcccggcggaccagtccgagctgggcccagagcagctggaggccgaagttggagagagctcggacgaggagccggtggagtccagggcccagcggctgcggcgcaccggattgcagaaggtacagagcctccgaagggccctttcgggccggaaaggccctgcagcgccaccgcccaccccggtcaagccgcctcgccttgggcctggccggagcgctgaagcccagccggaagcccagcctgcgctggagcccacgctggagccagagcctccgcaggacaccgaggaagatcccgggagacctggggctgccgaagaagctctgctccaaatggagagtgtagcctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolCAVIN3
-
Short namePRKCDBP cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameprotein phosphorylation catalyst C, delta binding protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetprotein kinase C, delta binding protein, PRKCDBP and IDBG-28654 and ENSG00000170955 and 112464, protein binding, Cell surfaces, Prkcdbp and IDBG-204708 and ENSMUSG00000037060 and 109042, PRKCDBP and IDBG-634211 and ENSBTAG00000019754 and 510203
-
Gene info
-
Identity
-
Gene
-
Long gene namecaveolae associated protein 3
-
Synonyms gene
-
Synonyms gene name
- protein kinase C, delta binding protein
- protein kinase C delta binding protein
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1999-01-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Cavins
-
VEGA ID