FKBP1B cloning plasmid

• Catalog number
  CSB-CL008692HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the FKBP1B gene.
• Specifications
  Gene name: FKBP1B; Gene ID: 2281; Accession number: BC002614; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 243; Sequence: atgggcgtggagatcgagaccatctcccccggagacggaaggacattccccaagaagggccaaacgtgtgtggtgcactacacaggaatgctccaaaatgggaagaagtttgattcatccagagacagaaacaaacctttcaagttcagaattggcaaacaggaagtcatcaaaggttttgaagagggtgcagcccagctgggtcctctttctcctctccccatctgcccccatccctgctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  FKBP1B   cloning  
• Gene symbol
  FKBP1B
• Short name
  FKBP1B cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  FK506 binding protein 1B, 12.6 kiloDalton cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  FK506 binding protein 1B, 12.6 kDa, FKBP12.6 and FKBP1L and OTK4 and PKBP1L and PPIase, FKBP1B and IDBG-33239 and ENSG00000119782 and 2281, ion channel binding, Plasma membranes, Fkbp1b and IDBG-128053 and ENSMUSG00000020635 and 14226, FKBP1B and IDBG-637475 and ENSBTAG00000003409 and 785179

Gene info

• Identity
  HGNC:3712
• Gene
  FKBP1B
• Long gene name
  FKBP prolyl isomerase 1B
• Synonyms gene
  • FKBP1L
• Synonyms gene name
  • FK506-binding protein 1B (12.6 kD)
  • FK506 binding protein 1B, 12.6 kDa
  • FK506 binding protein 1B
• Synonyms
  • OTK4
  • FKBP12.6
  • PPIase
  • FKBP9
• Synonyms name
  • calstabin 2
• GenBank acession
  • D38037
• Locus
  2p23.3
• Discovery year
  1999-02-15
• Entrez gene record
  2281
• Pubmed identfication
  • 7513996
• RefSeq identity
  • NM_004116
• Classification
  • FKBP prolyl isomerases
• VEGA ID
  OTTHUMG00000151889

Similar products