BCL7C cloning plasmid

  • Catalog number
    CSB-CL845147HU1-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the BCL7C gene.
  • Specifications
    Gene name: BCL7C; Gene ID: 9274; Accession number: BC019071; Vector: pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 654; Sequence: atggccggccggactgtacgggccgagacccggagccgggccaaggatgacatcaagaaggtgatggcgaccatcgagaaggtccggagatgggagaagcgatgggtgactgtgggcgacacttcccttcgtatcttcaagtgggtgccagtggtggatccccaggaggaggagcgaaggcgggcaggtggcggggcagagagatcccgtggccgggaacgtcggggcaggggcgccagtccccgagggggtggccctctcatcctgctggatcttaatgatgagaacagcaaccagagtttccattcggaaggttccctgcaaaagggcacagagcccagtcctgggggcaccccccagcccagccgccctgtgtcacctgccggacccccagaaggggtccctgaggaggctcagcccccacggctgggccaagagagagatcccgggggcataactgctggcagcaccgacgaacccccaatgctgaccaaggaggagcctgttccagaactgctggaagctgaggcccccgaagcttaccctgtctttgagccagtgccacctgtccctgaggcagcccagggtgacacagaggactcggagggtgcccccccactcaagcgcatctgcccaaatgcccctgacccctga
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    BCL7C   cloning  
  • Gene symbol
    BCL7C
  • Short name
    BCL7C cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    B-cellular CLL/lymphoma 7C cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    B-cell CLL/lymphoma 7C, BCL7C and IDBG-27159 and ENSG00000099385 and 9274, multiple, Bcl7c and IDBG-210325 and ENSMUSG00000030814 and 12055, BCL7C and IDBG-639483 and ENSBTAG00000008412 and
Gene info
  • Identity
  • Gene
  • Long gene name
    BAF chromatin remodeling complex subunit BCL7C
  • Synonyms gene name
    • B-cell CLL/lymphoma 7C
    • BCL tumor suppressor 7C
    • BCL7C, BAF complex component
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1999-03-19
  • Entrez gene record
  • Pubmed identfication
  • RefSeq identity
  • Classification
    • BAF complex
    • MicroRNA protein coding host genes
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee