MYL1 cloning plasmid
-
Catalog numberCSB-CL015305HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the MYL1 gene.
-
SpecificationsGene name: MYL1; Gene ID: 4632; Accession number: BC005318; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 453; Sequence: atgtccttcagtgctgaccagattgctgaattcaaggaggcatttctcctgtttgacagaacaggtgattccaagatcaccttaagccaggtcggtgatgtccttcgagctctgggcacaaatcccaccaatgcagaggtcaggaaagttctgggaaaccccagcaatgaagagctgaatgccaagaaaattgagtttgaacaatttctgcctatgatgcaagccatttccaacaacaaggaccaggccacctatgaagactttgttgagggtctgcgtgtctttgacaaggaaggcaatggcacagtcatgggtgctgaactccgccatgttctagccaccctgggtgaaaagatgaaagaggaagaagtggaagccctgatggcaggtcaagaagactccaatggctgcatcaactacgaagcttttgtcaagcacatcatgtctatctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolMYL1
-
Short nameMYL1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namemyosin, light chain 1, alkali; skeletal, fast cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetmyosin, light chain 1, alkali; skeletal, fast, MLC1F and MLC3F, MYL1 and IDBG-79939 and ENSG00000168530 and 4632, structural constituent of muscle, Cytoplasm, Myl1 and IDBG-163700 and ENSMUSG00000061816 and 17901, MYL1 and IDBG-643607 and ENSBTAG00000009707 and 317657
-
Gene info
-
Identity
-
Gene
-
Long gene namemyosin light chain 1
-
Synonyms gene name
- myosin, light polypeptide 1, alkali; skeletal, fast
- myosin, light chain 1, alkali; skeletal, fast
-
Locus
-
Discovery year1986-01-01
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Myosin light chains, class 1
-
VEGA ID