GRIK2 cloning plasmid

  • Catalog number
    CSB-CL618751HU1-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the GRIK2 gene.
  • Specifications
    Gene name: GRIK2; Gene ID: 2898; Accession number: BC037954; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1062; Sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagatttgctgtgaacacaattaacagaaacagaacattgctacccaatactacccttacctatgatacccagaagataaacctttatgatagttttgaagcatccaagaaagcctgtgatcagctgtctcttggggtggctgccatcttcgggccttcacacagctcatcagcaaacgcagtgcagtccatctgcaatgctctgggagttccccacatacagacccgctggaagcaccaggtgtcagacaacaaagattccttctatgtcagtctctacccagacttctcttcactcagccgtgccattttagacctggtgcagtttttcaagtggaaaaccgtcacggttgtgtatgatgacagcactggtctcattcgtttgcaagagctcatcaaagctccatcaaggtataatcttcgactcaaaattcgtcagttacctgctgatacaaaggatgcaaaacccttactaaaagaaatgaaaagaggcaaggagtttcatgtaatctttgattgtagccatgaaatggcagcaggcattttaaaacaggcattagctatgggaatgatgacagaatactatcattatatctttaccactctggacctctttgctcttgatgttgagccctaccgatacagtggtgttaacatgacagggttcagaatattaaatacagaaaatacccaagtctcctccatcattgaaaagtggtcgatggaacgattgcaggcacctccgaaacccgattcaggtttgctggatggatttatgacgatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatctcacctcactgcaacctctgcctcctgggttcaagcgattcttctgcctcagcctcccgagtag
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    GRIK2   cloning  
  • Gene symbol
    GRIK5, GRIK2
  • Short name
    GRIK2 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    glutamate receptor, ionotropic, kainate 2 cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    glutamate receptor, ionotropic, kainate 2, EAA4 and GLR6 and GluK2 and GLUK6 and GLUR6 and MRT6, GRIK2 and IDBG-94705 and ENSG00000164418 and 2898, protein homodimerization activity, Cell surfaces, Grik2 and IDBG-149430 and ENSMUSG00000056073 and 14806, GRIK2 and IDBG-631973 and ENSBTAG00000033153 and 615226
Gene info
  • Identity
  • Gene
  • Long gene name
    glutamate ionotropic receptor kainate type subunit 5
  • Synonyms gene
  • Synonyms gene name
    • glutamate receptor, ionotropic, kainate 5
  • Synonyms
  • Locus
  • Discovery year
    1993-10-21
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • Glutamate ionotropic receptor kainate type subunits
  • VEGA ID
Gene info
  • Identity
  • Gene
  • Long gene name
    glutamate ionotropic receptor kainate type subunit 2
  • Synonyms gene
  • Synonyms gene name
    • glutamate receptor, ionotropic, kainate 2
  • Synonyms
  • Locus
  • Discovery year
    1992-02-26
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • Glutamate ionotropic receptor kainate type subunits
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee