GRIK2 cloning plasmid
-
Catalog numberCSB-CL618751HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the GRIK2 gene.
-
SpecificationsGene name: GRIK2; Gene ID: 2898; Accession number: BC037954; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 1062; Sequence: atgaagattattttcccgattctaagtaatccagtcttcaggcgcaccgttaaactcctgctctgtttactgtggattggatattctcaaggaaccacacatgtattaagatttggtggtatttttgaatatgtggaatctggcccaatgggagctgaggaacttgcattcagatttgctgtgaacacaattaacagaaacagaacattgctacccaatactacccttacctatgatacccagaagataaacctttatgatagttttgaagcatccaagaaagcctgtgatcagctgtctcttggggtggctgccatcttcgggccttcacacagctcatcagcaaacgcagtgcagtccatctgcaatgctctgggagttccccacatacagacccgctggaagcaccaggtgtcagacaacaaagattccttctatgtcagtctctacccagacttctcttcactcagccgtgccattttagacctggtgcagtttttcaagtggaaaaccgtcacggttgtgtatgatgacagcactggtctcattcgtttgcaagagctcatcaaagctccatcaaggtataatcttcgactcaaaattcgtcagttacctgctgatacaaaggatgcaaaacccttactaaaagaaatgaaaagaggcaaggagtttcatgtaatctttgattgtagccatgaaatggcagcaggcattttaaaacaggcattagctatgggaatgatgacagaatactatcattatatctttaccactctggacctctttgctcttgatgttgagccctaccgatacagtggtgttaacatgacagggttcagaatattaaatacagaaaatacccaagtctcctccatcattgaaaagtggtcgatggaacgattgcaggcacctccgaaacccgattcaggtttgctggatggatttatgacgatggagtttcactcttgttgcccaggctggagtgcaatggcgcgatctcacctcactgcaacctctgcctcctgggttcaagcgattcttctgcctcagcctcccgagtag
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolGRIK5, GRIK2
-
Short nameGRIK2 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameglutamate receptor, ionotropic, kainate 2 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetglutamate receptor, ionotropic, kainate 2, EAA4 and GLR6 and GluK2 and GLUK6 and GLUR6 and MRT6, GRIK2 and IDBG-94705 and ENSG00000164418 and 2898, protein homodimerization activity, Cell surfaces, Grik2 and IDBG-149430 and ENSMUSG00000056073 and 14806, GRIK2 and IDBG-631973 and ENSBTAG00000033153 and 615226
-
Gene info
-
Identity
-
Gene
-
Long gene nameglutamate ionotropic receptor kainate type subunit 5
-
Synonyms gene
-
Synonyms gene name
- glutamate receptor, ionotropic, kainate 5
-
Synonyms
-
Locus
-
Discovery year1993-10-21
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Glutamate ionotropic receptor kainate type subunits
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameglutamate ionotropic receptor kainate type subunit 2
-
Synonyms gene
-
Synonyms gene name
- glutamate receptor, ionotropic, kainate 2
-
Synonyms
-
Locus
-
Discovery year1992-02-26
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Glutamate ionotropic receptor kainate type subunits
-
VEGA ID