PLEKHF1 cloning plasmid
-
Catalog numberCSB-CL842759HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PLEKHF1 gene.
-
SpecificationsGene name: PLEKHF1; Gene ID: 79156; Accession number: BC002744; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 840; Sequence: atggtggaccacttggccaacacggagatcaacagccagcgcatcgcggcagtggagagctgcttcggggcctcggggcagccgctggcgctgccaggccgagtgctgctgggcgagggcgtgctgaccaaagagtgccgcaagaaggccaagccgcgcatcttcttcctctttaacgacatcctggtgtatggcagcatcgtgctcaacaagcgcaagtaccgcagccagcacatcatccccctggaggaggtcacactggagctgttgccggagacgctgcaggccaagaaccgctggatgatcaagacggccaagaagtcctttgtggtgtcggccgcctccgctacggagcgccaggaatggattagccacatcgaggagtgcgtgcggcggcaactgagggccacgggccgcccgcccagcacggagcacgcggcaccctggatccccgacaaggccacggacatctgcatgcgctgcacgcagacgcgcttctctgccctcacgaggcgccaccactgccgcaagtgcggcttcgtggtctgcgctgagtgctcgcgccagcgcttcctgctcccgcgcctgtcccccaagcccgtgcgcgtctgcagcctctgctaccgcgaactggccgcccagcagcggcaggaggaggcggaggagcagggcgcggggtccccagggcagccagcccacctggcccggcccatctgcggagcgtccagtggagatgacgatgactccgacgaggacaaggagggcagcagggacggcgactggcccagcagcgtggagttctacgcctcgggggtggcctggtctgccttccacagctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPLEKHF1
-
Short namePLEKHF1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namepleckstrin homology domain containing, family F (including FYVE domain) member 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetpleckstrin homology domain containing, family F (with FYVE domain) member 1, PLEKHF1 and IDBG-41768 and ENSG00000166289 and 79156, phosphatidylinositol-4-phosphate binding, nuclei, Plekhf1 and IDBG-175598 and ENSMUSG00000074170 and 72287, PLEKHF1 and IDBG-634938 and ENSBTAG00000008625 and 782309
-
Gene info
-
Identity
-
Gene
-
Long gene namepleckstrin homology and FYVE domain containing 1
-
Synonyms gene name
- pleckstrin homology domain containing, family F (with FYVE domain) member 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2003-04-01
-
Entrez gene record
-
RefSeq identity
-
Classification
- Pleckstrin homology domain containing
- Zinc fingers FYVE-type
-
VEGA ID