PSMB1 cloning plasmid
-
Catalog numberCSB-CL018876HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the PSMB1 gene.
-
SpecificationsGene name: PSMB1; Gene ID: 5689; Accession number: BC000508; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 726; Sequence: atgttgtcctctacagccatgtattcggctgctggcagagacttggggatggaaccgcacagagccgcgggccctttgcagctgcgattttcgccctacgttttcaacggaggtactatactggcaattgctggagaagattttgcaattgttgcttctgatactcgattgagtgaagggttttcaattcatacgcgggatagccccaaatgttacaaattaacagacaaaacagtcattggatgcagcggttttcatggagactgtcttacgctgacaaagattattgaagcaagactaaagatgtataagcattccaataataaggccatgactacgggggcaattgctgcaatgctgtctacaatcctgtattcaaggcgcttctttccatactatgtttacaacatcatcggtggacttgatgaagaaggaaagggggctgtatacagctttgatccagtagggtcttaccagagagactccttcaaggctggaggctcagcaagtgccatgctacagcccctgcttgacaaccaggttggttttaagaacatgcagaatgtggagcatgttccgctgtccttggacagagccatgcggctggtgaaagatgtcttcatttctgcggctgagagagatgtgtacactggggacgcactccggatctgcatagtgaccaaagagggcatcagggaggaaactgtttccttaaggaaggactga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolPSMB1
-
Short namePSMB1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameproteasome (prosome, macropain) subunit, b classification, 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetproteasome (prosome, macropain) subunit, beta type, 1, HC5 and PMSB1 and PSC5, PSMB1 and IDBG-99310 and ENSG00000008018 and 5689, protein binding, nuclei, Psmb1 and IDBG-139866 and ENSMUSG00000014769 and 19170, PSMB1 and IDBG-636181 and ENSBTAG00000007685 and 514237
-
Gene info
-
Identity
-
Gene
-
Long gene nameproteasome 20S subunit beta 1
-
Synonyms gene name
- proteasome (prosome, macropain) subunit, beta type, 1
- proteasome subunit beta 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1995-05-03
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Proteasome
-
VEGA ID