NFATC2IP cloning plasmid

• Catalog number
  CSB-CL822758HU2-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NFATC2IP gene.
• Specifications
  Gene name: NFATC2IP; Gene ID: 84901; Accession number: BC068007; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 384; Sequence: atggccacccaccttggggtgtccccaagcaggatccttttgctttttggagagacagagctatcacctactgccactcccaggaccctaaagctcggagtggctgacatcattgactgtgtggtactaacaagttctccagaggccacagagacgtcccaacagctccagctccgggtgcagggaaaggagaaacaccagacactggaagtctcactgtctcgagattcccctctaaagaccctcatgtcccactatgaggaggccatgggactgtcgggacggaagctctccttcttctttgatgggacaaagctttcaggcagggagctgccagctgacctgggcatggaatctggggacctcattgaggtctggggctga
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NFATC2IP   cloning  
• Gene symbol
  NFATC2IP
• Short name
  NFATC2IP cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  nuclear factor on activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein, NFATC2IP and IDBG-23865 and ENSG00000176953 and 84901, protein binding, nuclei, Nfatc2ip and IDBG-209458 and ENSMUSG00000030722 and 18020, NFATC2IP and IDBG-638888 and ENSBTAG00000014650 and 505998

Gene info

• Identity
  HGNC:25906
• Gene
  NFATC2IP
• Long gene name
  nuclear factor of activated T cells 2 interacting protein
• Synonyms gene name
  • nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 2 interacting protein
  • nuclear factor of activated T-cells 2 interacting protein
• Synonyms
  • FLJ14639
  • NIP45
  • RAD60
  • ESC2
• GenBank acession
  • AK074761
• Locus
  16p11.2
• Discovery year
  2005-01-11
• Entrez gene record
  84901
• Pubmed identfication
  • 15698469
• RefSeq identity
  • NM_032815
• Classification
  • MicroRNA protein coding host genes
• VEGA ID
  OTTHUMG00000097763

Similar products