RBCK1 cloning plasmid
-
Catalog numberCSB-CL880138HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the RBCK1 gene.
-
SpecificationsGene name: RBCK1; Gene ID: 10616; Accession number: BC000983; Vector: pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 693; Sequence: atgggcacagccacgccagatggacgagaagaccaagaaaggctgtgggtgagcgtggaggatgctcagatgcacaccgtcaccatctggctcacagtgcgccctgatatgacagtggcgtctctcaaggacatggtttttctggactatggcttcccaccagtcttgcagcagtgggtgattgggcagcggctggcacgagaccaggagaccctgcactcccatggggtgcggcagaatggggacagtgcctacctctatctgctgtcagcccgcaacacctccctcaaccctcaggagctgcagcgggagcggcagctgcggatgctggaagatctgggcttcaaggacctcacgctgcagccgcggggccctctggagccaggccccccaaagcccggggtcccccaggaacccggacgggggcagccagatgcagtgcctgagcccccaccggtgggctggcagtgccccgggtgcaccttcatcaacaagcccacgcggcctggctgtgagatgtgctgccgggcgcgccccgaggcctaccaggtccccgcctcataccagcccgacgaggaggagcgagcgcgcctggcgggcgaggaggaggcgctgcgtcagtaccagcagggagtgcctgcagggcaccatccgcaacagccaggaggcggaggtctcctgccccttcattga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolRBCK1
-
Short nameRBCK1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameRanBP-classification and C3HC4-classification zinc finger containing 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetRanBP-type and C3HC4-type zinc finger containing 1, C20orf18 and HOIL-1 and HOIL1 and PBMEI and RBCK2 and RNF54 and UBCE7IP3 and XAP3 and XAP4 and ZRANB4, RBCK1 and IDBG-37270 and ENSG00000125826 and 10616, ubiquitin binding, multiple, Rbck1 and IDBG-209659 and ENSMUSG00000027466 and 24105, C20ORF18 and IDBG-641465 and ENSBTAG00000017002 and 504400
-
Gene info
-
Identity
-
Gene
-
Long gene nameRANBP2-type and C3HC4-type zinc finger containing 1
-
Synonyms gene
-
Synonyms gene name
- chromosome 20 open reading frame 18
- RanBP-type and C3HC4-type zinc finger containing 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2001-06-21
-
Entrez gene record
-
RefSeq identity
-
Classification
- Zinc fingers RANBP2-type
- Ring finger proteins
- RBR E3 ubiquitin ligases
- Linear ubiquitin chain assembly complex
-
VEGA ID
-
Locus Specific Databases