SLURP1 cloning plasmid
-
Catalog numberCSB-CL021784HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the SLURP1 gene.
-
SpecificationsGene name: SLURP1; Gene ID: 57152; Accession number: BC069292; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 312; Sequence: atggcctctcgctgggctgtgcagctgctgctcgtggcagcctggagcatgggctgtggtgaggccctcaagtgctacacctgcaaggagcccatgaccagtgcttcctgcaggaccattacccgctgcaagccagaggacacagcctgcatgaccacgctggtgacggtggaggcagagtaccccttcaaccagagccccgtggtgacccgctcctgctccagctcctgtgtggccaccgaccccgacagcatcggggccgcccacctgatcttctgctgcttccgagacctctgcaactcggaactctga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolSLURP1
-
Short nameSLURP1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namesecreted LY6/plasminogen activator, urokinase receptor domain containing 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetsecreted LY6/PLAUR domain containing 1, SLURP1 and IDBG-37775 and ENSG00000126233 and 57152, cytokine activity, Extracellular, Slurp1 and IDBG-150101 and ENSMUSG00000022596 and 57277, SLURP1 and IDBG-643876 and ENSBTAG00000016209 and 618706
-
Gene info
-
Identity
-
Gene
-
Long gene namesecreted LY6/PLAUR domain containing 1
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2004-11-16
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- LY6/PLAUR domain containing
-
VEGA ID