AGGF1 cloning plasmid
-
Catalog numberCSB-CL001444HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the AGGF1 gene.
-
SpecificationsGene name: AGGF1; Gene ID: 55109; Accession number: BC002828; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 330; Sequence: atggcctcggaggcgccgtccccgccgcggtcgccgccgccgcccacctcccccgagcctgagctggcccagctaaggcggaaggtggagaagttggaacgtgaactgcggagctgcaagcggcaggtgcgggagatcgagaagctgctgcatcacacagaacggctgtaccagaacgcagaaagcaacaaccaggagctccgcacgcaggtgcgcggtcctcctcagccccgcgccccatccagcccaggcgaggccttcgaagcccgtgatagcctcggaaggggtccctggcaggggctcagaactactgtagagtacttaaagtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolAGGF1
-
Short nameAGGF1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameangiogenic factor including G patch and FHA domains 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetangiogenic factor with G patch and FHA domains 1, AGGF1 and IDBG-29861 and ENSG00000164252 and 55109, protein binding, Extracellular, Aggf1 and IDBG-173830 and ENSMUSG00000021681 and 66549, AGGF1 and IDBG-645167 and ENSBTAG00000034823 and 511650
-
Gene info
-
Identity
-
Gene
-
Long gene nameangiogenic factor with G-patch and FHA domains 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2004-12-14
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- G-patch domain containing
-
VEGA ID