LNP1 cloning plasmid
-
Catalog numberCSB-CL013020HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LNP1 gene.
-
SpecificationsGene name: LNP1; Gene ID: 348801; Accession number: BC126362; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 537; Sequence: atggagcacaaagatgatgatgatgatgatgtgtcttttgccaaatggatgagcagcttctggggccacagctggagagaggaggatcagagaggactccgggaacgccaccgactgcaagccaccagtcacaggaaaacctccctgccctgcccacttcctgtgcttcccagaattccatcatctgactgccatcctagaaggcattctcatgaggaccaagaatttcgatgccgtagccacgtacgggattacagaaaatactcagaggatgggtcattcaaggagccactggaatcaaaaggaagatcccattccaaaattgagaaattttcagagtcctttgaacggcaactgtgctttagaaccaagcgttctgcctctttgggacctgaaagcagaaaggagagaaatgaaagagaatgcctgaggatggagataaaatcccgaaagaaagtagaggaagaaaggagctctaggaaagaagagcatggagaagcacacatggctcccctgtttgaaaaagggcctgaataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLNP1, LNPK
-
Short nameLNP1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameleukemia NUP98 fusion partner 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetleukemia NUP98 fusion partner 1, LNP1 and IDBG-47381 and ENSG00000206535 and 348801, multiple, LNP1 and IDBG-631256 and ENSBTAG00000034442 and 507217
-
Gene info
-
Identity
-
Gene
-
Long gene nameleukemia NUP98 fusion partner 1
-
Synonyms
-
Locus
-
Discovery year2005-12-20
-
Entrez gene record
-
Pubmed identfication
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene namelunapark, ER junction formation factor
-
Synonyms gene
-
Synonyms gene name
- KIAA1715
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year2003-11-26
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID