THAP1 cloning plasmid
-
Catalog numberCSB-CL885741HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the THAP1 gene.
-
SpecificationsGene name: THAP1; Gene ID: 55145; Accession number: BC021721; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 642; Sequence: atggtgcagtcctgctccgcctacggctgcaagaaccgctacgacaaggacaagcccgtttctttccacaagtttcctcttactcgacccagtctttgtaaagaatgggaggcagctgtcagaagaaaaaactttaaacccaccaagtatagcagtatttgttcagagcactttactccagactgctttaagagagagtgcaacaacaagttactgaaagagaatgctgtgcccacaatatttctttgtactgagccacatgacaagaaagaagatcttctggagccacaggaacagcttcccccacctcctttaccgcctcctgtttcccaggttgatgctgctattggattactaatgccgcctcttcagacccctgttaatctctcagttttctgtgaccacaactatactgtggaggatacaatgcaccagcggaaaaggattcatcagctagaacagcaagttgaaaaactcagaaagaagctcaagaccgcacagcagcgatgcagaaggcaagaacggcagcttgaaaaattaaaggaggttgttcacttccagaaagagaaagacgacgtatcagaaagaggttatgtgattctaccaaatgactactttgaaatagttgaagtaccagcataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTHAP1
-
Short nameTHAP1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameTHAP domain containing, apoptosis associated protein 1 cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetTHAP domain containing, apoptosis associated protein 1, THAP1 and IDBG-20415 and ENSG00000131931 and 55145, sequence-specific DNA binding, nuclei, Thap1 and IDBG-145273 and ENSMUSG00000037214 and 73754, THAP1 and IDBG-629979 and ENSBTAG00000007629 and 538615
-
Gene info
-
Identity
-
Gene
-
Long gene nameTHAP domain containing 1
-
Synonyms gene
-
Synonyms gene name
- dystonia 6, torsion (autosomal dominant)
- THAP domain containing, apoptosis associated protein 1
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2003-07-21
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- THAP domain containing
-
VEGA ID