LIMS1 cloning plasmid
-
Catalog numberCSB-CL012955HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the LIMS1 gene.
-
SpecificationsGene name: LIMS1; Gene ID: 3987; Accession number: BC005341; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 978; Sequence: atggccaacgccctggccagcgccacttgcgagcgctgcaagggcggctttgcgcccgctgagaagatcgtgaacagtaatggggagctgtaccatgagcagtgtttcgtgtgcgctcagtgcttccagcagttcccagaaggactcttctatgagtttgaaggaagaaagtactgtgaacatgactttcagatgctctttgccccttgctgtcatcagtgtggtgaattcaccattggccgagttatcaaagccatgaataacagctggcatccggagtgcttccgctgtgacctctgccaggaagttctggcagatatcgggtttgtcaagaatgctgggagacacctgtgtcgcccctgtcataatcgtgagaaagccagaggccttgggaaatacatctgccagaaatgccatgctatcatcgatgagcagcctctgatattcaagaacgacccctaccatccagaccatttcaactgcgccaactgcgggaaggagctgactgccgatgcacgggagctgaaaggggagctatactgcctcccatgccatgataaaatgggggtccccatctgtggtgcttgccgacggcccatcgaagggcgcgtggtgaacgctatgggcaagcagtggcatgtggagcattttgtttgtgccaagtgtgagaaaccctttcttggacatcgccattatgagaggaaaggcctggcatattgtgaaactcactataaccagctatttggtgatgtttgcttccactgcaatcgtgttatagaaggtggtgtggtctctgctcttaataaggcctggtgcgtgaactgctttgcctgttctacctgcaacactaaattaacactcaagaataagtttgtggagtttgacatgaagccagtctgtaagaagtgctatgagaaatttccattggagctgaagaaaagacttaagaaactagctgagaccttaggaaggaaataa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolLIMS1-AS1, LIMS1
-
Short nameLIMS1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameLIM and senescent cellular antigen-like-containing domain protein 3; LIM and senescent cellular antigen-like-containing domain protein 3-like; Uncharacterized protein; complementary Desoxyribonucleic acid FLJ59124, highly similar to Particularly interesting newCys-histidine protein; complementary Desoxyribonucleic acid, FLJ79109, highly similar to Particularly interesting newCys-histidine protein cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetLIM and senescent cell antigen-like-containing domain protein 3; LIM and senescent cell antigen-like-containing domain protein 3-like; Uncharacterized protein; cDNA FLJ59124, highly similar to Particularly interesting newCys-His protein; cDNA, FLJ79109, highly similar to Particularly interesting newCys-His protein, LIMS1 and IDBG-544075 and ENSG00000257207 and, zinc ion binding, Cytoplasm
-
Gene info
-
Identity
-
Gene
-
Long gene nameLIMS1 antisense RNA 1
-
GenBank acession
-
Locus
-
Discovery year2015-03-11
-
Classification
- Antisense RNAs
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameLIM zinc finger domain containing 1
-
Synonyms gene name
- LIM and senescent cell antigen-like domains 1
- LIM-type zinc finger domains 1
-
Synonyms
-
Synonyms name
-
Locus
-
Discovery year1998-01-15
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- LIM domain containing
- LIM zinc finger domain containing
-
VEGA ID