AHSG cloning plasmid

• Catalog number
  CSB-CL001485HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the AHSG gene.
• Specifications
  Gene name: AHSG; Gene ID: 197; Accession number: BC052590; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1104; Sequence: atgaagtccctcgtcctgctcctttgtcttgctcagctgtggggctgccactcagccccacatggcccagggctgatttatagacaaccgaactgcgatgatccagaaactgaggaagcagctctggtggctatagactacatcaatcaaaaccttccttggggatacaaacacaccttgaaccagattgatgaagtaaaggtgtggcctcagcagccctccggagagctgtttgagattgaaatagacaccctggaaaccacctgccatgtgctggaccccacccctgtggcaagatgcagcgtgaggcagctgaaggagcatgctgtcgaaggagactgtgatttccagctgttgaaactagatggcaagttttccgtggtatacgcaaaatgtgattccagtccagactcagccgaggacgtgcgcaaggtgtgccaagactgccccctgctggccccgctgaacgacaccagggtggtgcacgccgcgaaagctgccctggccgccttcaacgctcagaacaacggctccaattttcagctggaggaaatttcccgggctcagcttgtgcccctcccaccttctacctatgtggagtttacagtgtctggcactgactgtgttgctaaagaggccacagaggcagccaagtgtaacctgctggcagaaaagcaatatggcttttgtaaggcaacactcagtgagaagcttggtggggcagaggttgcagtgacctgcacggtgttccaaacacagcccgtgacctcacagccccaaccagaaggtgccaatgaagcagtccccacccccgtggtggacccagatgcacctccgtcccctccacttggcgcacctggactccctccagctggctcacccccagactcccatgtgttactggcagctcctccaggacaccagttgcaccgggcgcactacgacctgcgccacaccttcatgggtgtggtctcattggggtcaccctcaggagaagtgtcgcacccccggaaaacacgcacagtggtgcagcctagtgttggtgctgctgctgggccagtggttcctccatgtccggggaggatcagacacttcaaggtctag
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  AHSG   cloning  
• Gene symbol
  AHSG
• Short name
  AHSG cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  alpha-2-HS-glycoprotein cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  alpha-2-HS-glycoprotein, A2HS and AHS and FETUA and HSGA, AHSG and IDBG-68916 and ENSG00000145192 and 197, kinase inhibitor activity, Extracellular, Ahsg and IDBG-148706 and ENSMUSG00000022868 and 11625, AHSG and IDBG-634683 and ENSBTAG00000000522 and 280988

Gene info

• Identity
  HGNC:349
• Gene
  AHSG
• Long gene name
  alpha 2-HS glycoprotein
• Synonyms
  • FETUA
  • A2HS
  • HSGA
• Synonyms name
  • fetuin A
• GenBank acession
  • D67013
  • M16961
• Locus
  3q27.3
• Discovery year
  1986-01-01
• Entrez gene record
  197
• Pubmed identfication
  • 9322749
  • 7736783
• RefSeq identity
  • NM_001622
• Classification
  • Cystatins, type 4
• VEGA ID
  OTTHUMG00000156605

Similar products