NFIL3 cloning plasmid

• Catalog number
  CSB-CL621967HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the NFIL3 gene.
• Specifications
  Gene name: NFIL3; Gene ID: 4783; Accession number: BC008197; Vector: pUC
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 1389; Sequence: atgcagctgagaaaaatgcagaccgtcaaaaaggagcaggcgtctcttgatgccagtagcaatgtggacaagatgatggtccttaattctgctttaacggaagtgtcagaagactccacaacaggtgaggagctgcttctcagtgaaggaagtgtggggaagaacaaatcttctgcatgtcggaggaaacgggaattcattcctgatgaaaagaaagatgctatgtattgggaaaaaaggcggaaaaataatgaagctgccaaaagatctcgtgagaagcgtcgactgaatgacctggttttagagaacaaactaattgcactgggagaagaaaacgccactttaaaagctgagctgctttcactaaaattaaagtttggtttaattagctccacagcatatgctcaagagattcagaaactcagtaattctacagctgtgtactttcaagattaccagacttccaaatccaatgtgagttcatttgtggacgagcacgaaccctcgatggtgtcaagtagttgtatttctgtcattaaacactctccacaaagctcgctgtccgatgtttcagaagtgtcctcagtagaacacacgcaggagagctctgtgcagggaagctgcagaagtcctgaaaacaagttccagattatcaagcaagagccgatggaattagagagctacacaagggagccaagagatgaccgaggctcttacacagcgtccatctatcaaaactatatggggaattctttctctgggtactcacactctcccccactactgcaagtcaaccgatcctccagcaactccccgagaacgtcggaaactgatgatggtgtggtaggaaagtcatctgatggagaagacgagcaacaggtccccaagggccccatccattctccagttgaactcaagcatgtgcatgcaactgtggttaaagttccagaagtgaattcctctgccttgccacacaagctccggatcaaagccaaagccatgcagatcaaagtagaagcctttgataatgaatttgaggccacgcaaaaactttcctcacctattgacatgacatctaaaagacatttcgaactcgaaaagcatagtgccccaagtatggtacattcttctcttactcctttctcagtgcaagtgactaacattcaagattggtctctcaaatcggagcactggcatcaaaaagaactgagtggcaaaactcagaatagtttcaaaactggagttgttgaaatgaaagacagtggctacaaagtttctgacccagagaacttgtatttgaagcaggggatagcaaacttatctgcagaggttgtctcactcaagagacttatagccacacaaccaatctctgcttcagactctgggtaa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  NFIL3   cloning  
• Gene symbol
  NFIL3
• Short name
  NFIL3 cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  nuclear factor, interleukin 3 regulated cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  nuclear factor, interleukin 3 regulated, E4BP4 and IL3BP1 and NF-IL3A and NFIL3A, NFIL3 and IDBG-75722 and ENSG00000165030 and 4783, sequence-specific DNA binding, nuclei, Nfil3 and IDBG-152923 and ENSMUSG00000056749 and 18030, NFIL3 and IDBG-647479 and ENSBTAG00000017763 and 506097

Gene info

• Identity
  HGNC:7787
• Gene
  NFIL3
• Long gene name
  nuclear factor, interleukin 3 regulated
• Synonyms gene
  • IL3BP1
• Synonyms gene name
  • interleukin-3 binding protein 1
• Synonyms
  • E4BP4
  • NFIL3A
  • NF-IL3A
• Synonyms name
  • E4 promoter-binding protein
  • adenovirus E4 promoter region binding protein
• GenBank acession
  • X64318
• Locus
  9q22.31
• Discovery year
  1995-02-13
• Entrez gene record
  4783
• Pubmed identfication
  • 7565758
  • 1620116
• RefSeq identity
  • NM_005384
• Classification
  • Basic leucine zipper proteins
• VEGA ID
  OTTHUMG00000020209

Similar products