TSPO cloning plasmid
-
Catalog numberCSB-CL025168HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TSPO gene.
-
SpecificationsGene name: TSPO; Gene ID: 706; Accession number: BC001110; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 510; Sequence: atggccccgccctgggtgcccgccatgggcttcacgctggcgcccagcctggggtgcttcgtgggctcccgctttgtccacggcgagggtctccgctggtacgccggcctgcagaagccctcgtggcacccgccccactgggtgctgggccctgtctggggcacgctctactcagccatggggtacggctcctacctggtctggaaagagctgggaggcttcacagagaaggctgtggttcccctgggcctctacactgggcagctggccctgaactgggcatggccccccatcttctttggtgcccgacaaatgggctgggccttggtggatctcctgctggtcagtggggcggcggcagccactaccgtggcctggtaccaggtgagcccgctggccgcccgcctgctctacccctacctggcctggctggccttcgcgaccacactcaactactgcgtatggcgggacaaccatggctggcatgggggacggcggctgccagagtga
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTSPO
-
Short nameTSPO cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nametranslocator protein (18kDa) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targettranslocator protein (18kDa), BPBS and BZRP and DBI and IBP and MBR and mDRC and PBR and PBS and pk18 and PKBS and PTBR, TSPO and IDBG-10470 and ENSG00000100300 and 706, cholesterol binding, nuclei, Tspo and IDBG-168372 and ENSMUSG00000041736 and 12257, TSPO and IDBG-642147 and ENSBTAG00000018073 and 281033
-
Gene info
-
Identity
-
Gene
-
Long gene nametranslocator protein
-
Synonyms gene
-
Synonyms gene name
- benzodiazapine receptor (peripheral)
- translocator protein (18kDa)
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1991-05-25
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
VEGA ID