FSHB cloning plasmid

• Catalog number
  CSB-CL009018HU-10ug
• Price
  Please ask
• Size
  10ug

• Description
  A cloning plasmid for the FSHB gene.
• Specifications
  Gene name: FSHB; Gene ID: 2488; Accession number: BC113488; Vector: pENTR223.1
• Additional_information
  Formulation: 10 μg plasmid + 200μl Glycerol; Length: 390; Sequence: atgaagacactccagtttttcttccttttctgttgctggaaagcaatctgctgcaatagctgtgagctgaccaacatcaccattgcaatagagaaagaagaatgtcgtttctgcataagcatcaacaccacttggtgtgctggctactgctacaccagggatctggtgtataaggacccagccaggcccaaaatccagaaaacatgtaccttcaaggaactggtatacgaaacagtgagagtgcccggctgtgctcaccatgcagattccttgtatacatacccagtggccacccagtgtcactgtggcaagtgtgacagcgacagcactgattgtactgtgcgaggcctggggcccagctactgctcctttggtgaaatgaaagaataa
• Storage_and_shipping
  Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
• Notes
  For research use only.
• Kit
  Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.

• Gene target
  FSHB   cloning  
• Gene symbol
  FSHB
• Short name
  FSHB cloning plasmid
• Technique
  plasmid, plasmids in 1
• Alternative name
  follicle stimulating hormone, beta polypeptide cloning plasmid
• Alternative technique
  plasmids
• Alternative to gene target
  follicle stimulating hormone, beta polypeptide, FSHB and IDBG-37119 and ENSG00000131808 and 2488, protein binding, Extracellular, Fshb and IDBG-195409 and ENSMUSG00000027120 and 14308

Gene info

• Identity
  HGNC:3964
• Gene
  FSHB
• Long gene name
  follicle stimulating hormone subunit beta
• Synonyms gene name
  • follicle stimulating hormone, beta polypeptide
• Synonyms name
  • follitropin, beta chain
• Locus
  11p14.1
• Discovery year
  1986-01-01
• Entrez gene record
  2488
• Pubmed identfication
  • 2885163
  • 3151250
• RefSeq identity
  • NM_000510
• Classification
  • Receptor ligands
  • Glycoprotein hormone subunits
• VEGA ID
  OTTHUMG00000166146

Similar products