RAC1 cloning plasmid
-
Catalog numberCSB-CL019242HU2-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the RAC1 gene.
-
SpecificationsGene name: RAC1; Gene ID: 5879; Accession number: BC050687; Vector: pENTR223.1
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 579; Sequence: atgcaggccatcaagtgtgtggtggtgggagacggagctgtaggtaaaacttgcctactgatcagttacacaaccaatgcatttcctggagaatatatccctactgtctttgacaattattctgccaatgttatggtagatggaaaaccggtgaatctgggcttatgggatacagctggacaagaagattatgacagattacgccccctatcctatccgcaaacagatgtgttcttaatttgcttttcccttgtgagtcctgcatcatttgaaaatgtccgtgcaaagtggtatcctgaggtgcggcaccactgtcccaacactcccatcatcctagtgggaactaaacttgatcttagggatgataaagacacgatcgagaaactgaaggagaagaagctgactcccatcacctatccgcagggtctagccatggctaaggagattggtgctgtaaaatacctggagtgctcggcgctcacacagcgaggcctcaagacagtgtttgacgaagcgatccgagcagtcctctgcccgcctcccgtgaagaagaggaagagaaaatgcctgctgttgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolRAC1, RNASE1
-
Short nameRAC1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameras-related complement component 3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1), p21-Rac1 and Rac-1 and TC-25, RAC1 and IDBG-8115 and ENSG00000136238 and 5879, Rho GDP-dissociation inhibitor binding, Plasma membranes, Rac1 and IDBG-207763 and ENSMUSG00000001847 and 19353, RAC1 and IDBG-641023 and ENSBTAG00000009233 and 281440
-
Gene info
-
Identity
-
Gene
-
Long gene nameRac family small GTPase 1
-
Synonyms gene name
- ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1993-11-05
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Rho family GTPases
- Receptor ligands
-
VEGA ID
Gene info
-
Identity
-
Gene
-
Long gene nameribonuclease A family member 1, pancreatic
-
Synonyms gene
-
Synonyms gene name
- ribonuclease, RNase A family, 1 (pancreatic)
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year1990-02-24
-
Entrez gene record
-
Pubmed identfication
-
Classification
- Ribonuclease A family
-
VEGA ID