RAC1 cloning plasmid

  • Catalog number
    CSB-CL019242HU2-10ug
  • Price
    Please ask
  • Size
    10ug
  • Description
    A cloning plasmid for the RAC1 gene.
  • Specifications
    Gene name: RAC1; Gene ID: 5879; Accession number: BC050687; Vector: pENTR223.1
  • Additional_information
    Formulation: 10 μg plasmid + 200μl Glycerol; Length: 579; Sequence: atgcaggccatcaagtgtgtggtggtgggagacggagctgtaggtaaaacttgcctactgatcagttacacaaccaatgcatttcctggagaatatatccctactgtctttgacaattattctgccaatgttatggtagatggaaaaccggtgaatctgggcttatgggatacagctggacaagaagattatgacagattacgccccctatcctatccgcaaacagatgtgttcttaatttgcttttcccttgtgagtcctgcatcatttgaaaatgtccgtgcaaagtggtatcctgaggtgcggcaccactgtcccaacactcccatcatcctagtgggaactaaacttgatcttagggatgataaagacacgatcgagaaactgaaggagaagaagctgactcccatcacctatccgcagggtctagccatggctaaggagattggtgctgtaaaatacctggagtgctcggcgctcacacagcgaggcctcaagacagtgtttgacgaagcgatccgagcagtcctctgcccgcctcccgtgaagaagaggaagagaaaatgcctgctgttgtaa
  • Storage_and_shipping
    Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
  • Notes
    For research use only.
  • Kit
    Plasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
  • Gene target
    RAC1   cloning  
  • Gene symbol
    RAC1, RNASE1
  • Short name
    RAC1 cloning plasmid
  • Technique
    plasmid, plasmids in 1
  • Alternative name
    ras-related complement component 3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1) cloning plasmid
  • Alternative technique
    plasmids
  • Alternative to gene target
    ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein Rac1), p21-Rac1 and Rac-1 and TC-25, RAC1 and IDBG-8115 and ENSG00000136238 and 5879, Rho GDP-dissociation inhibitor binding, Plasma membranes, Rac1 and IDBG-207763 and ENSMUSG00000001847 and 19353, RAC1 and IDBG-641023 and ENSBTAG00000009233 and 281440
Gene info
Gene info
  • Identity
  • Gene
  • Long gene name
    ribonuclease A family member 1, pancreatic
  • Synonyms gene
  • Synonyms gene name
    • ribonuclease, RNase A family, 1 (pancreatic)
  • Synonyms
  • GenBank acession
  • Locus
  • Discovery year
    1990-02-24
  • Entrez gene record
  • Pubmed identfication
  • Classification
    • Ribonuclease A family
  • VEGA ID
Similar products
Filters
Contact
Chat with gentaur.com employee