MNAT1 cloning plasmid
-
Catalog numberCSB-CL014686HU-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the MNAT1 gene.
-
SpecificationsGene name: MNAT1; Gene ID: 4331; Accession number: BC000820; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 930; Sequence: atggacgatcagggttgccctcggtgtaagaccaccaaatatcggaacccctccttgaagctgatggtgaatgtgtgcggacacactctctgtgaaagttgtgtagatttactgtttgtgagaggagctggaaactgccctgagtgtggtactccactcagaaagagcaacttcagggtacaactctttgaagatcccactgttgacaaggaggttgagatcaggaaaaaagtgctaaagatatacaataaaagggaagaagattttcctagtctaagagaatacaatgatttcttggaagaagtggaagaaattgttttcaacttgaccaacaatgtggatttggacaacaccaaaaagaaaatggagatataccaaaaggaaaacaaagatgttattcagaaaaataaattaaagctgactcgagaacaggaagaactggaagaagctttagaagtggaacgacaggaaaatgaacaaagaagattatttatacaaaaagaagaacaactgcagcagattctaaaaaggaagaataagcaggcttttttagatgagctggagagttctgatctccctgttgctctgcttttggctcagcataaagatagatctacccaattagaaatgcaacttgagaaacccaaacctgtaaaaccagtgacgttttccacaggcatcaaaatgggtcaacatatttcactggcacctattcacaagcttgaagaagctctgtatgaataccagccactgcagatagagacatatggaccacatgttcctgagcttgagatgctaggaagacttgggtatttaaaccatgtcagagctgcctcaccacaggaccttgctggaggctatacttcttctcttgcttgtcacagagcactacaggatgcattcagtgggcttttctggcagcccagttaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolMNAT1
-
Short nameMNAT1 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative namemenage a trois homolog 1, cyclin H assembly factor (Xenopus laevis) cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetmenage a trois homolog 1, cyclin H assembly factor (Xenopus laevis), CAP35 and MAT1 and RNF66 and TFB3, MNAT1 and IDBG-8368 and ENSG00000020426 and 4331, protein N-terminus binding, nuclei, Mnat1 and IDBG-148230 and ENSMUSG00000021103 and 17420, MNAT1 and IDBG-646752 and ENSBTAG00000030801 and 534176
-
Gene info
-
Identity
-
Gene
-
Long gene nameMNAT1 component of CDK activating kinase
-
Synonyms gene name
- menage a trois 1 (CAK assembly factor)
- menage a trois homolog 1, cyclin H assembly factor (Xenopus laevis)
- MNAT CDK-activating kinase assembly factor 1
- MNAT1, CDK activating kinase assembly factor
-
Synonyms
-
Synonyms name
-
GenBank acession
-
Locus
-
Discovery year1997-10-09
-
Entrez gene record
-
Pubmed identfication
-
RefSeq identity
-
Classification
- Nucleotide excision repair
- CDK activating kinase complex
- Ring finger proteins
-
VEGA ID