TAF8 cloning plasmid
-
Catalog numberCSB-CL773805HU1-10ug
-
PricePlease ask
-
Size10ug
-
-
DescriptionA cloning plasmid for the TAF8 gene.
-
SpecificationsGene name: TAF8; Gene ID: 129685; Accession number: BC033728; Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC
-
Additional_informationFormulation: 10 μg plasmid + 200μl Glycerol; Length: 525; Sequence: atggccgacgcggcggccacagctggggccggtggctccggaacgagatcgggaagtaaacagtccactaaccctgccgataactatcatctggcccggaggagaaccctgcaggtggttgtgagctccttgctgacagaggcagggtttgagagtgccgagaaagcatccgtggaaacgctgacagagatgctgcagagctacatttcagaaattgggagaagtgccaagtcttactgtgagcacacagccaggacccagcccacactgtccgatatcgtggtcacacttgttgagatgggtttcaatgtggacactctccctgcttatgcaaaacggtctcagaggatggtcatcactgctcctccggtgaccaatcagccagtgacccccaaggccctcactgcagggcagaaccgaccccacccgccgcacatccccagccattttcctgagttccctgatccccacacctacatcaaaactccggtgagtgatgaagcactgggactgcgcgtggtgtaa
-
Storage_and_shippingTransported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.
-
NotesFor research use only.
-
KitPlasmid mini made and maxi DNA purification kits can be silica gel or anion exchange, endotoxin free and are used to produce pure plasmids that are small DNA molecules within a cell separated from chromosomal DNA and can replicate independently. They are most commonly found in bacteria as small circular, double-stranded DNA molecules; however, plasmids are sometimes present in archaea and eukaryotic organisms. In nature, plasmids often carry genes that may benefit the survival of the organism, for example antibiotic resistance. While the chromosomes are big and contain all the essential information for living, plasmids usually are very small and contain only additional information. Artificial plasmids are widely used as vectors in molecular cloning, serving to drive the replication of recombinant DNA sequences within host organisms.
-
Gene target
-
Gene symbolTAF8
-
Short nameTAF8 cloning plasmid
-
Techniqueplasmid, plasmids in 1
-
Alternative nameTAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa cloning plasmid
-
Alternative techniqueplasmids
-
Alternative to gene targetTAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa, TAF8 and IDBG-87010 and ENSG00000137413 and 129685, protein heterodimerization activity, nuclei, Taf8 and IDBG-189216 and ENSMUSG00000023980 and 63856, TAF8 and IDBG-631023 and ENSBTAG00000011339 and 539938
-
Gene info
-
Identity
-
Gene
-
Long gene nameTATA-box binding protein associated factor 8
-
Synonyms gene
-
Synonyms gene name
- TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 45/50kDa
- taube nuss homolog (mouse)
- TAF8 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 43kDa
-
Synonyms
-
GenBank acession
-
Locus
-
Discovery year2001-12-03
-
Entrez gene record
-
RefSeq identity
-
Classification
- General transcription factor IID complex subunits
-
VEGA ID